Correlation of WD 40 repeat 43 expression in lung adenocarcinoma and its effect on paclitaxel-resistance of cells

doi:10.3969/j.issn.1674-8115.2022.12.002

Abstract

Abstract:

Objective ·To investigate the expression of WD 40 repeat protein 43 (WDR43) mRNA in lung adenocarcinoma (LUAD) cells and its correlation with the prognosis of LUAD patients, and analyze the effect of WDR43 on the paclitaxel-resistance of LUAD cells. Methods ·Cancer Therapeutics Response Portal (CTRP) was used to download the correlation coefficient between gene expression and paclitaxel sensitivity of LUAD cells, and the paclitaxel resistance-associated genes were screened. Gene Ontology (GO) function analysis and Kyoto Encyclopedia of Genes and Genome (KEGG) pathway analysis were used to analyze the paclitaxel resistance-associated genes, and WDR43 gene was chosen to perform further study. Human Protein Atlas (HPA) database was used to explore the expression and location of WDR43 protein in LUAD tissues. The cancer genome atlas (TCGA) database was retrieved to analyze the difference of WDR43 mRNA expression in LUAD tissues and normal lung tissues, the mutation of WDR43 in LUAD patients, and the correlation between WDR43 mRNA and clinicopathological factors. CaArray database was used to analyze the relationship between WDR43 mRNA and the prognosis of LUAD patients. Tumor Immune Estimation Resource (TIMER) was used to analyze the relationship between WDR43 expression and the infiltration level of immune cells in LUAD tissues. The expressions of WDR43 gene in LUAD cell lines were analyzed by Cancer Cell Line Encyclopedia (CCLE) database, the WDR43 differential-expressed LUAD cells were constructed and the effect of WDR43 expression on paclitaxel resistance was validated by MTT assay and plate colony formation assay. Results ·WDR43, a paclitaxel sensitivity-related gene, was selected by CTRP. The results of GO function analysis and KEGG pathway analysis showed that WDR43 and other genes were associated with rRNA processing and regulation of cell shape, and were enriched on the pathway such as herpes simplex virus 1 infection and cytosolic DNA-sensing pathway. The analysis results of HPA database showed that WDR43 protein was mainly expressed in the cellular nucleus, cellular cytoplasm and cellular membrane of LUAD tissues. The analysis results of TCGA database showed that the expression of WDR43 mRNA in LUAD tissues was higher than that in normal lung tissues (P=0.000), the expression in cancer tissues of LUAD smokers was higher than that of non-smokers (P=0.000), and the expression in TP53 mutant patients was also higher than that in TP53 wild-type patients (P=0.000). The analysis results of CaArray database showed that LUAD patients with WDR43 mRNA-high expression had poor prognosis (both P=0.000). The analysis results of TIMER database showed that the expression of WDR43 could promote the infiltration level of neutrophils, CD8⁺T cells, myeloid-derived suppressor cells and macrophages, and inhibit the infiltration level of CD4⁺T cells in LUAD tissues. In vitro experiments confirmed that overexpression of WDR43 could enhance the drug resistance of LUAD cells to paclitaxel. Conclusion ·The expression of WDR43 in LUAD tissues is significantly increased and negatively correlated with the prognosis of patients. Overexpression of WDR43 could enhance the paclitaxel resistance of LUAD cells.

Key words: WD40 repeat 43 (WDR43), lung adenocarcinoma, paclitaxel, chemoresistance, prognosis

CLC Number:

R734.2

ZHAO Xue, DONG Chunyan. Correlation of WD 40 repeat 43 expression in lung adenocarcinoma and its effect on paclitaxel-resistance of cells[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(12): 1656-1665.

Figures/Tables 9

TrendMD

References 20

1	SUNG H, FERLAY J, SIEGEL R L, et al. Global cancer statistics 2020: globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2021, 71(3): 209-249.
2	O'KEEFFE L M, TAYLOR G, HUXLEY R R, et al. Smoking as a risk factor for lung cancer in women and men: a systematic review and meta-analysis[J]. BMJ Open, 2018, 8(10): e021611.
3	SHEN D J, WANG J F, WU J, et al. Neoadjuvant pembrolizumab with chemotherapy for the treatment of stage ⅡB-ⅢB resectable lung squamous cell carcinoma[J]. J Thorac Dis, 2021, 13(3): 1760-1768.
4	CHENG Z A, YU C T, CUI S H, et al. circTP63 functions as a ceRNA to promote lung squamous cell carcinoma progression by upregulating FOXM1[J]. Nat Commun, 2019, 10(1): 3200.
5	WEST H, MCCLEOD M, HUSSEIN M, et al. Atezolizumab in combination with carboplatin plus nab-paclitaxel chemotherapy compared with chemotherapy alone as first-line treatment for metastatic non-squamous non-small-cell lung cancer (IMpower130): a multicentre, randomised, open-label, phase 3 trial[J]. Lancet Oncol, 2019, 20(7): 924-937.
6	MUELLER H S, FOWLER C E, DALIN S, et al. Acquired resistance to PRMT5 inhibition induces concomitant collateral sensitivity to paclitaxel[J]. Proc Natl Acad Sci USA, 2021, 118(34): e2024055118.
7	CAI X Y, CHEN Z H, DENG M L, et al. Unique genomic features and prognostic value of COSMIC mutational signature 4 in lung adenocarcinoma and lung squamous cell carcinoma[J]. Ann Transl Med, 2020, 8(18): 1176.
8	SUGAWARA S, LEE J S, KANG J H, et al. Nivolumab with carboplatin, paclitaxel, and bevacizumab for first-line treatment of advanced nonsquamous non-small-cell lung cancer[J]. Ann Oncol, 2021, 32(9): 1137-1147.
9	SONDALLE S B, BASERGA S J, YELICK P C. The contributions of the ribosome biogenesis protein Utp5/WDR43 to craniofacial development[J]. J Dent Res, 2016, 95(11): 1214-1220.
10	PEÑA C, HURT E, PANSE V G. Eukaryotic ribosome assembly, transport and quality control[J]. Nat Struct Mol Biol, 2017, 24(9): 689-699.
11	BI X J, XU Y H, LI T, et al. RNA targets ribogenesis factor WDR43 to chromatin for transcription and pluripotency control[J]. Mol Cell, 2019, 75(1): 102-116.e9.
12	PARANT J M, GEORGE S A, PRYOR R, et al. A rapid and efficient method of genotyping zebrafish mutants[J]. Dev Dyn, 2009, 238(12): 3168-3174.
13	COUCH F J, KUCHENBAECKER K B, MICHAILIDOU K, et al. Identification of four novel susceptibility loci for oestrogen receptor negative breast cancer[J]. Nat Commun, 2016, 7: 11375.
14	MENDOZA-FANDIÑO G, LYRA P C M, NEPOMUCENO T C, et al. Two distinct mechanisms underlie estrogen-receptor-negative breast cancer susceptibility at the 2p23.2 locus[J]. Eur J Hum Genet, 2022, 30(4): 465-473.
15	LI Z J, FENG M, ZHANG J, et al. WD40 repeat 43 mediates cell survival, proliferation, migration and invasion via vimentin in colorectal cancer[J]. Cancer Cell Int, 2021, 21(1): 418.
16	HUANG Z Y, LI F, LI Q C. Expression profile of RNA binding protein in cervical cancer using bioinformatics approach[J]. Cancer Cell Int, 2021, 21(1): 647.
17	SCHAPIRA M, TYERS M, TORRENT M, et al. WD40 repeat domain proteins: a novel target class?[J]. Nat Rev Drug Discov, 2017, 16(11): 773-786.
18	UHLÉN M, FAGERBERG L, HALLSTRÖM B M, et al. Proteomics. Tissue-based map of the human proteome[J]. Science, 2015, 347(6220): 1260419.
19	SUN H J, SUN Q, QIU X, et al. WD repeat domain 43 promotes malignant progression of non-small cell lung cancer by regulating CDK2[J]. Int J Biochem Cell Biol, 2022, 151: 106293.
20	史清文. 天然药物化学史话: 紫杉醇[J]. 中草药, 2011, 42(10): 1878-1884.
	SHI Q W. Historical story on natural medicinal chemistry of Taxol[J]. Chinese Traditional and Herbal Drugs, 2011, 42(10): 1878-1884.

Primer	Forward （5’→3’）	Reverse （5’→3’）
WDR43	CCTACTTCGCTTTGGCCTCTA	GAAGGCACGTACTCCTGGTG
GAPDH	AATGGGCAGCCGTTAGGAAA	GCCCAATACGACCAAATCAGAG

Primer	Forward （5’→3’）	Reverse （5’→3’）
WDR43	CCTACTTCGCTTTGGCCTCTA	GAAGGCACGTACTCCTGGTG
GAPDH	AATGGGCAGCCGTTAGGAAA	GCCCAATACGACCAAATCAGAG

Clinicopathological factor	WDR43 mRNA-low expression group （n=267）	WDR43 mRNA-high expression group （n=268）	P value
Age/year	66 （59， 73）	66 （59， 72）	0.614
Gender/n（%）			0.010
Female	158 （59.18）	128 （47.76）
Male	109 （40.82）	140 （52.24）
T stage/n（%）			0.003
T1	106 （39.70）	69 （25.75）
T2	129 （48.31）	160 （59.70）
T3	24 （8.99）	25 （9.33）
T4	6 （2.25）	13 （4.85）
N stage/n（%）			0.023
N0	181 （67.79）	167 （62.31）
N1	49 （18.35）	46 （17.16）
N2	25 （9.36）	49 （18.28）
N3	1 （0.37）	1 （0.37）
M stage/n（%）			0.142
M0	178 （66.67）	183 （68.28）
M1	8 （3.00）	17 （6.34）
Tumor stage/n（%）			0.033
Stage 1	157 （58.80）	137 （51.12）
Stage 2	64 （23.97）	59 （22.01）
Stage 3	32 （11.99）	52 （19.40）
Stage 4	9 （3.37）	17 （6.34）
Smoking/n（%）			0.000
No	53 （19.85）	22 （8.21）
Yes	203 （76.03）	243 （90.67）
Number of smoking/n（%）			0.988
<40 packets per year	84 （41.38）	104 （42.80）
≥40 packets per year	82 （40.39）	99 （40.74）

Clinicopathological factor	WDR43 mRNA-low expression group （n=267）	WDR43 mRNA-high expression group （n=268）	P value
Age/year	66 （59， 73）	66 （59， 72）	0.614
Gender/n（%）			0.010
Female	158 （59.18）	128 （47.76）
Male	109 （40.82）	140 （52.24）
T stage/n（%）			0.003
T1	106 （39.70）	69 （25.75）
T2	129 （48.31）	160 （59.70）
T3	24 （8.99）	25 （9.33）
T4	6 （2.25）	13 （4.85）
N stage/n（%）			0.023
N0	181 （67.79）	167 （62.31）
N1	49 （18.35）	46 （17.16）
N2	25 （9.36）	49 （18.28）
N3	1 （0.37）	1 （0.37）
M stage/n（%）			0.142
M0	178 （66.67）	183 （68.28）
M1	8 （3.00）	17 （6.34）
Tumor stage/n（%）			0.033
Stage 1	157 （58.80）	137 （51.12）
Stage 2	64 （23.97）	59 （22.01）
Stage 3	32 （11.99）	52 （19.40）
Stage 4	9 （3.37）	17 （6.34）
Smoking/n（%）			0.000
No	53 （19.85）	22 （8.21）
Yes	203 （76.03）	243 （90.67）
Number of smoking/n（%）			0.988
<40 packets per year	84 （41.38）	104 （42.80）
≥40 packets per year	82 （40.39）	99 （40.74）

[1]	CHEN Siyuan, SHI Qing, FU Di, WANG Li, CHENG Shu, XU Pengpeng, ZHAO Weili. Clinicopathologic characteristics, gene mutation profile, and prognostic analysis of diffuse large B-cell lymphoma with lung involvement [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(9): 1214-1220.
[2]	YAN Zhi, WU Xingyue, YAO Weiqin, YAN Lingzhi, JIN Song, SHANG Jingjing, SHI Xiaolan, WU Depei, FU Chengcheng. Dynamic changes and prognostic significance of immunoparesis in newly diagnosed multiple myeloma patients [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(7): 807-814.
[3]	WU Lei, DU Fenglin, ZHAO Mingna, REN Yizhe, ZHANG Xianzhou, LOU Jiatao. Expression of PTPRN in lung adenocarcinoma and its mechanism of promoting tumor metastasis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(7): 846-857.
[4]	XU Tianyun, SHEN Yiming, JIANG Meng. Clinical management of heart failure with improved ejection fraction: treatment and maintenance [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(4): 493-499.
[5]	WANG Boen, CHEN Siyuan, SHI Qing, ZHANG Muchen, YI Hongmei, DONG Lei, WANG Li, CHENG Shu, XU Pengpeng, ZHAO Weili. Clinicopathologic characteristics of patients with kidney-involved diffuse large B-cell lymphoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1162-1168.
[6]	XU Wanxing, WANG Lin, GUO Qiaomei, WANG Xueqing, LOU Jiatao. Clinical validation and application value exploration of multi-modal pulmonary nodule diagnosis model [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(8): 1030-1036.
[7]	ZHU Mingyang, XU Yuanyuan, REN Jianghao, HUANG Jiazheng, LI Ruonan, TAN Qiang. Review of sublobar resection for lung adenocarcinoma with ground-glass presence [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(7): 922-927.
[8]	SONG Chenlu, XIANG Jun, YANG Huizhong. Early alarming effect of serum heparin-binding protein on prognosis and occurrence of sepsis in severely burned patients [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 474-481.
[9]	WANG Guijie, DU Chuanchong, LU Ye, ZHAO Jian, SHEN Xie, JIN Donglin, GENG Jiacai. Changes of serum high mobility group box 1 and soluble triggering receptor expressed on myeloid cells-1 in patients with multiple injuries and their prognostic significance [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(3): 350-357.
[10]	WANG Mengfei, YANG Shouzhi, QIAO Yongxia, HUANG Lin. Establishment of discriminative models for predicting the infiltration degree of patients with lung adenocarcinoma based on clinical laboratory indicators [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(1): 98-107.
[11]	LUO Mengxing, ZOU Xin, GAO Yaxian, WU Xiaocui, YU Fangyou, HU Yang, ZENG Qibing, LIU Zhonghua. Analysis of the effect of anti-tuberculosis treatment and lung injury in patients with tuberculosis combined with underlying disease [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(8): 1017-1023.
[12]	LI Ying, TAN Yangxia, YIN Hongxin, JIANG Yanling, CHEN Li, MENG Guoyu. Research progress in the pathogenesis and prognosis of ZNF384 fusion subtype acute leukemia [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(5): 631-640.
[13]	MEN Ru, ZHU Minxia, ZHANG Weiming. Serum potassium level in maintenance hemodialysis patients and its effect on outcome [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(4): 507-513.
[14]	WANG Anjun, LIU Ningning. Efficacy of radiotherapy in patients with rectal cancer undergoing chemotherapy and surgery: a retrospective study based on the SEER database [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(3): 320-332.
[15]	LI Fang, LI Kaiyang, WANG Jue, YAN Ruiyang, SHEN Hui, LIU Min. Expression and clinical significance of PLA2G2A in kidney renal papillary cell carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(2): 152-161.