Effect of potential pathogenic gene PDX1 variants of total anomalous pulmonary venous connection on its gene function

doi:10.3969/j.issn.1674-8115.2023.10.001

Abstract

Abstract:

Objective ·To explore the possible pathogenic gene of total anomalous pulmonary venous connection (TAPVC) by whole exon sequencing and verify its function. Methods ·One hundred TAPVC children (case group) and one hundred and twenty healthy children (control group) in Xinhua Hospital and Shanghai Children's Medical Center, Shanghai Jiao Tong University School of Medicine from 2014 to 2019 were included. The blood samples from the two groups of children were collected, and whole blood genomic DNA was extracted for exon sequencing to screen out the potential pathogenic genes of TAPVC. Harmful mutation sites of pathogenic genes were screened through Mutation Taster, SIFT and PolyPhen-2 websites, and then conducted by Sanger sequencing. The wild-type (wild-type group) and mutant (mutant group) plasmids of PDX1 were transfected into HUVEC cells. Quantitative real-time PCR (qPCR) and Western blotting were used to detect the effects of mutations on mRNA and protein levels of PDX1, respectively. The STRING database was used to analyze the interaction between proteins, and qPCR was used to determine the expressions of downstream genes regulated by PDX1. Results ·Pathogenic PDX1 was found in TAPVC children, and Sanger sequencing revealed two novel variants in the gene: c.C237A (P33T) and c. C237G (P33A). Compared with the wild-type group, there was no significant difference in PDX1 mRNA levels in the two mutant groups, but there was a significant increase in relative protein expression of the CA group and CG group, which was 2.9 and 3.4 times higher than the wild-type group, respectively (P=0.000, P=0.001). Protein interaction analysis demonstrated that PDX1 was associated with SOX17. qPCR results showed that overexpression of PDX1 could downregulate the expression of SOX17 in HUVEC. Conclusion ·The two novel PDX1 missense mutations can affect the process of PDX1 post-transcriptional translation, indicating that PDX1 may participate in the occurrence and development of TAPVC by regulating SOX17.

Key words: total anomalous pulmonary venous connection (TAPVC), PDX1, missense mutation, SOX17, human umbilical vein endothelial cell (HUVEC)

CLC Number:

R725.4

FENG Weiqi, ZHANG Qi, WU Yizhuo, LU Yanan, YU Yu. Effect of potential pathogenic gene PDX1 variants of total anomalous pulmonary venous connection on its gene function[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(10): 1219-1226.

Figures/Tables 8

Tab 1 Primer sequence for PDX1 mutation plasmids

Primer	Forward sequence (5'→3')	Reverse sequence (5'→3')
C237A mutation	CAGGCACGCAGCGGGGCTGGCGC	CGCGGTCGGGGTGACGCACGGAC
C237G mutation	GCGCCAGCCCCGCTGCGTGCCTG	CGCGGTCGGGGCGACGCACGGAC

Tab 2 Primer sequence for qPCR

Primer	Forward sequence (5'→3')	Reverse sequence (5'→3')
PDX1	TGAGATCCAGTTCGATGTAA	CAAGTAGGTATCAACGGACT
β-actin	GGCCAACCGCGAGAAGATGAC	CAACGATAGGTCCGACACGATAGG

Fig 1 Sequence chromatograms of PDX1 missense variants in the healthy child and 2 TAPVC children

Tab 3 Characteristics of mutation sites in PDX1 in the two TAPVC children

Patient ID	Gender	Age/month	Location in age	Base change	Amino change	SIFT	Mutation taster	PolyPhen-2
A03	Male	2	Exon237	C237A	P33T	0 (D)	DC	0.996 (D)
B11	Female	4	Exon237	C237G	P33A	0 (D)	DC	0.997 (D)

Fig 2 Comparison of the conservation of protein sequences encoded by PDX1 among different species

Fig 3 Effect of two mutations of PDX1 on its mRNA and protein expression

Fig 4 Protein-protein interaction network between PDX1 and other proteins

Fig 5 Effect of overexpression of PDX1 and its mutants on the expression of SOX17

TrendMD

References 24

1	KAO C C, HSIEH C C, CHENG P J, et al. Total anomalous pulmonary venous connection: from embryology to a prenatal ultrasound diagnostic update[J]. J Med Ultrasound, 2017, 25(3): 130-137.
2	PALADINI D, PISTORIO A, WU L H, et al. Prenatal diagnosis of total and partial anomalous pulmonary venous connection: multicenter cohort study and meta-analysis[J]. Ultrasound Obstet Gynecol, 2018, 52(1): 24-34.
3	RELLER M D, STRICKLAND M J, RIEHLE-COLARUSSO T, et al. Prevalence of congenital heart defects in metropolitan Atlanta, 1998‒2005[J]. J Pediatr, 2008, 153(6): 807-813.
4	HERLONG J R, JAGGERS J J, UNGERLEIDER R M. Congenital Heart Surgery Nomenclature and Database Project: pulmonary venous anomalies[J]. Ann Thorac Surg, 2000, 69(4 suppl): S56-S69.
5	CRAIG J M, DARLING R C, ROTHNEY W B. Total pulmonary venous drainage into the right side of the heart; report of 17 autopsied cases not associated with other major cardiovascular anomalies[J]. Lab Invest, 1957, 6(1): 44-64.
6	NEILL C A, FERENCZ C, SABISTON D C, et al. The familial occurrence of hypoplastic right lung with systemic arterial supply and venous drainage "scimitar syndrome"[J]. Bull Johns Hopkins Hosp, 1960, 107: 1-21.
7	LI J, YANG S W, PU Z N, et al. Whole-exome sequencing identifies SGCD and ACVRL1 mutations associated with total anomalous pulmonary venous return (TAPVR) in Chinese population[J]. Oncotarget, 2017, 8(17): 27812-27819.
8	CINQUETTI R, BADI I, CAMPIONE M, et al. Transcriptional deregulation and a missense mutation define ANKRD1 as a candidate gene for total anomalous pulmonary venous return[J]. Hum Mutat, 2008, 29(4): 468-474.
9	HOLLAND A M, HALE M A, KAGAMI H, et al. Experimental control of pancreatic development and maintenance[J]. Proc Natl Acad Sci U S A, 2002, 99(19): 12236-12241.
10	STOFFERS D A, ZINKIN N T, STANOJEVIC V, et al. Pancreatic agenesis attributable to a single nucleotide deletion in the human IPF1 gene coding sequence[J]. Nat Genet, 1997, 15(1): 106-110.
11	GÜRSON C T, TAHSINOGLU M, YAKACIKLI S, et al. A case of agenesis of the dorsal pancreas with interventricular septal defect in an infant[J]. Helv Paediatr Acta, 1970, 25(5): 522-526.
12	YORIFUJI T, MATSUMURA M, OKUNO T, et al. Hereditary pancreatic hypoplasia, diabetes mellitus, and congenital heart disease: a new syndrome?[J]. J Med Genet, 1994, 31(4): 331-333.
13	D'AMATO E, GIACOPELLI F, GIANNATTASIO A, et al. Genetic investigation in an Italian child with an unusual association of atrial septal defect, attributable to a new familial GATA4 gene mutation, and neonatal diabetes due to pancreatic agenesis[J]. Diabet Med, 2010, 27(10): 1195-1200.
14	BHUSHAN A, ITOH N, KATO S, et al. Fgf10 is essential for maintaining the proliferative capacity of epithelial progenitor cells during early pancreatic organogenesis[J]. Development, 2001, 128(24): 5109-5117.
15	WANG W P, SHI Q, GUO T, et al. PDX1 and ISL1 differentially coordinate with epigenetic modifications to regulate insulin gene expression in varied glucose concentrations[J]. Mol Cell Endocrinol, 2016, 428: 38-48.
16	HAN M, ZHOU B. Sox17 and coronary arteriogenesis in development[J]. Circ Res, 2020, 127(11): 1381-1383.
17	WU Y, WHARTON J, WALTERS R, et al. The pathophysiological role of novel pulmonary arterial hypertension gene SOX17[J]. Eur Respir J, 2021, 58(3): 2004172.
18	FLEMING R J. Structural conservation of Notch receptors and ligands[J]. Semin Cell Dev Biol, 1998, 9(6): 599-607.
19	HE X, SEMENOV M, TAMAI K, et al. LDL receptor-related proteins 5 and 6 in Wnt/β-catenin signaling: arrows point the way[J]. Development, 2004, 131(8): 1663-1677.
20	SMITH D W. Recognizable patterns of human malformation[J]. Major Probl Clin Pediatr, 1976, 7: 1-497.
21	SHI X, LU Y, SUN K. Research progress in pathogenesis of total anomalous pulmonary venous connection[J]. Methods Mol Biol, 2020, 2204: 173-178.
22	DEGENHARDT K, SINGH M K, AGHAJANIAN H, et al. Semaphorin 3d signaling defects are associated with anomalous pulmonary venous connections[J]. Nat Med, 2013, 19(6): 760-765.
23	王静, 金理辉, 张琪, 等. 完全性肺静脉异位引流患儿的ARHGEF16基因突变筛查及突变功能分析[J]. 上海交通大学学报(医学版), 2020, 40(1): 70-75
	WANG J, JIN L H, ZHANG Q, et al. ARHGEF16 variants screening and mutation function analysis for children with total anomalous pulmonary venous connection[J]. J Shanghai Jiao Tong Univ (Med Sci), 2020, 40(1): 70-75
24	EBRAHIM N, SHAKIROVA K, DASHINIMAEV E. PDX1 is the cornerstone of pancreatic β-cell functions and identity[J]. Front Mol Biosci, 2022, 9: 1091757.

[1]	WANG Qunfeng, LIU Shihua. A case of spinocerebellar ataxia type 28 with orthostatic tremor [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(4): 514-518.
[2]	Li LIU, Zi-long GENG, Jia-huan CHEN, Sha-sha ZHANG, Bing ZHANG. Whole gene expression profile analysis of miRNAs in human umbilical vein endothelial cells regulated by vascular endothelial growth factor A [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(9): 1183-1189.
[3]	Run-ze YANG, Wen-ning XU, Huo-liang ZHENG, Sheng-dan JIANG. Effects of exosomes derived from human umbilical vein endothelial cells on apoptosis of pre-chondrogenic cells stimulated by inflammatory factors [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(2): 147-153.
[4]	WANG Jing, JIN Li-hui, ZHANG Qi, SUN Kun, YU Yu. ARHGEF16 variants screening and mutation function analysis for children with total anomalous pulmonary venous connection [J]. , 2020, 40(1): 70-.
[5]	YAO Meng-sha, LIU Jun. A sporadic case of tuberous sclerosis complex caused by a newly found heterozygous missense mutation of c.T1967C in TSC1 gene [J]. , 2017, 37(6): 881-.
[6]	ZHANG Er-ge, XU Yue-juan, CHEN Sun, XU Rang, SUN Kun. JAG1 gene screening and mutation function analysis for an Alagille syndrome patient [J]. , 2016, 36(11): 1599-.
[7]	WANG Ye-fei, XIA Wen-quan, NI Pei-hua, et al. Analysis of glucose-6-phosphate dehydrogenase gene mutations: a novel missense mutation [J]. , 2010, 30(6): 698-.