Establishment and phenotype verification of mouse oviductal epithelial organoids

doi:10.3969/j.issn.1674-8115.2023.07.007

Abstract

Abstract:

Objective ·To establish a culture system of oviductal epithelial organoids from wild type (WT) mice and miR-34b/c^-/- and miR-449^-/- double knockout (dKO) mice, and verify the phenotypes. Methods ·The oviduct epithelial cells of WT mice and dKO mice were isolated and purified by enzyme digestion and differential adhesion method, and the purity of the isolated oviduct epithelial cells was identified by immunofluorescence staining. The numbers, growth rates and sizes of oviductal epithelial organoids between WT mice and dKO mice were compared by counting and diameter measurement. Hematoxylin-eosin (H-E) staining and transmission electron microscope (TEM) were used to observe the morphology and structure of the oviductal epithelial organoids. The proportions of ciliated cells and secretory cells in the oviductal epithelial organoids from WT mice and dKO mice were observed and counted by immunofluorescence staining. Immunohistochemistry (IHC), real-time quantitative PCR (RT-qPCR) and Western blotting were used to observe the expression levels of marker genes of ciliated cells and secretory cells in the oviductal epithelial organoids. Results ·The purity of the isolated and purified oviduct epithelial cells was high. Compared with the organoids from WT mice, the oviductal epithelial organoids from dKO mice grew faster and larger, and were more in number. But they developed more slowly than those from WT mice, as the invaginations of the dKO mice organoids appeared on the 28th day of culture, while the WT mice organoids exhibited the same structures on the 16th day. The oviductal epithelial organoids showed similar structures as those of the oviduct in vivo under hematoxylin-eosin (H-E) staining and TEM. Immunofluorescence staining showed that the ciliated cells of oviductal epithelial organoids from dKO mice were significantly reduced and the secretory cells were significantly increased (both P<0.05). IHC showed that the molecular expression patterns of the oviductal epithelial organoids were consistent with those of the oviducts in vivo, i.e. the expression levels of ciliated cell markers acetylated α-tubulin (Ac-α-tubulin) and forkhead box J1 (FOXJ1) decreased, and the expression level of the secretory cell marker paired box 8 (PAX8) increased. RT-qPCR showed that the mRNA levels of Foxj1 and tubulin β class Ⅳa (Tubb4a) decreased (both P<0.05), while Pax8 increased in the oviductal epithelial organoids of dKO mice (P<0.05). Western blotting results showed that the protein expression level of FOXJ1 in the organoids of dKO mice significantly decreased, while the expression of PAX8 significantly increased (both P<0.05). Conclusion ·The culture system of oviductal epithelial organoids of WT mice and dKO mice are successfully constructed, which can simulate the phenotypes of mouse oviduct in vivo.

Key words: organoid, oviduct, epithelial cell, miR-34, miR-449, gene knockout

CLC Number:

R-332

WU Qiqian, HU Yanqin, CHEN Jiale, LI Muchen, ZHAO Yougan, WU Jingwen. Establishment and phenotype verification of mouse oviductal epithelial organoids[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(7): 848-859.

Figures/Tables 7

Tab 1 Primer sequences in RT-qPCR

Primer	Sequence (5′→3′)
Foxj1-F	AAGGAGGCAGAAATCCGGTG
Foxj1-R	TTGTAGCCTCCCTTGTGCAG
Pax8-F	CCCTTCGCCATAAAGCAGGA
Pax8-R	AGCATGGGGAAAGGCATTGA
Tubb4a-F	AACCCGGCACCATGGACTCTGT
Tubb4a-R	TGCCTGCTCCGGATTGACCAAATA
Ovgp1-F	TGGACCCCTTTCTTTGTACG
Ovgp1-R	TGGACAGCAGTGTTTTCAGC
Gapdh-F	TGGAAAGCTGTGGCGTGAT
Gapdh-R	GGGTAGGAACACGGAAGGC

Fig 1 Morphological comparison of oviductal epithelial organoids from WT mice and dKO mice

Fig 2 Long-term culture and passage of oviductal epithelial organoids

Fig 3 Structure of the oviductal epithelial organoids under light microscopy (H-E staining, ×400)

Fig 4 Microstructures of ciliated cells and secretory cells in the oviductal epithelial organoids

Fig 5 Cell composition of the oviductal epithelial organoids

Fig 6 Expression levels of ciliated cell- and secretory cell-related genes in oviductal epithelial organoids

TrendMD

References 28

1	LI S, WINUTHAYANON W. Oviduct: roles in fertilization and early embryo development[J]. J Endocrinol, 2017, 232(1): R1-R26.
2	TALBOT P, SHUR B D, MYLES D G. Cell adhesion and fertilization: steps in oocyte transport, sperm-zona pellucida interactions, and sperm-egg fusion[J]. Biol Reprod, 2003, 68(1): 1-9.
3	KÖLLE S, DUBIELZIG S, REESE S, et al. Ciliary transport, gamete interaction, and effects of the early embryo in the oviduct: ex vivo analyses using a new digital videomicroscopic system in the cow[J]. Biol Reprod, 2009, 81(2): 267-274.
4	CHEN S, SCHOEN J. Air-liquid interface cell culture: from airway epithelium to the female reproductive tract[J]. Reprod Domest Anim, 2019, 54(Suppl 3): 38-45.
5	CUI Y T, ZHAO H Q, WU S W, et al. Human female reproductive system organoids: applications in developmental biology, disease modelling, and drug discovery[J]. Stem Cell Rev Rep, 2020, 16(6): 1173-1184.
6	KLASVOGT S, ZUSCHRATTER W, SCHMIDT A, et al. Air-liquid interface enhances oxidative phosphorylation in intestinal epithelial cell line IPEC-J2[J]. Cell Death Discov, 2017, 3: 17001.
7	ANDREI G, DURAFFOUR S, VAN DEN OORD J, et al. Epithelial raft cultures for investigations of virus growth, pathogenesis and efficacy of antiviral agents[J]. Antiviral Res, 2010, 85(3): 431-449.
8	LI D D, LI H, WANG Y, et al. Development and characterization of a polarized human endometrial cell epithelia in an air-liquid interface state[J]. Stem Cell Res Ther, 2018, 9(1): 209.
9	LEVANON K, NG V, PIAO H Y, et al. Primary ex vivo cultures of human fallopian tube epithelium as a model for serous ovarian carcinogenesis[J]. Oncogene, 2010, 29(8): 1103-1113.
10	CHEN S, PALMA-VERA S E, KEMPISTY B, et al. In vitro mimicking of estrous cycle stages: dissecting the impact of estradiol and progesterone on oviduct epithelium[J]. Endocrinology, 2018, 159(9): 3421-3432.
11	ZHU M B, IWANO T, TAKEDA S. Fallopian tube basal stem cells reproducing the epithelial sheets in vitro-stem cell of fallopian epithelium[J]. Biomolecules, 2020, 10(9): 1270.
12	RAJAGOPAL M, TOLLNER T L, FINKBEINER W E, et al. Differentiated structure and function of primary cultures of monkey oviductal epithelium[J]. In Vitro Cell Dev Biol Anim, 2006, 42(8/9): 248-254.
13	DVORAK A, TILLEY A E, SHAYKHIEV R, et al. Do airway epithelium air-liquid cultures represent the in vivo airway epithelium transcriptome?[J]. Am J Respir Cell Mol Biol, 2011, 44(4): 465-473.
14	ALZAMIL L, NIKOLAKOPOULOU K, TURCO M Y. Organoid systems to study the human female reproductive tract and pregnancy[J]. Cell Death Differ, 2021, 28(1): 35-51.
15	ROSSI G, MANFRIN A, LUTOLF M P. Progress and potential in organoid research[J]. Nat Rev Genet, 2018, 19(11): 671-687.
16	CLEVERS H. Modeling development and disease with organoids[J]. Cell, 2016, 165(7): 1586-1597.
17	HUCH M, KNOBLICH J A, LUTOLF M P, et al. The hope and the hype of organoid research[J]. Development, 2017, 144(6): 938-941.
18	MEBARKI M, BENNACEUR A, BONHOMME-FAIVRE L. Human-cell-derived organoids as a new ex vivo model for drug assays in oncology[J]. Drug Discov Today, 2018, 23(4): 857-863.
19	KESSLER M, HOFFMANN K, BRINKMANN V, et al. The Notch and Wnt pathways regulate stemness and differentiation in human fallopian tube organoids[J]. Nat Commun, 2015, 6: 8989.
20	XIE Y, PARK E S, XIANG D X, et al. Long-term organoid culture reveals enrichment of organoid-forming epithelial cells in the fimbrial portion of mouse fallopian tube[J]. Stem Cell Res, 2018, 32: 51-60.
21	WU J W, BAO J Q, KIM M, et al. Two miRNA clusters, miR-34b/c and miR-449, are essential for normal brain development, motile ciliogenesis, and spermatogenesis[J]. Proc Natl Acad Sci U S A, 2014, 111(28): E2851-E2857.
22	YUAN S Q, WANG Z Q, PENG H Y, et al. Oviductal motile cilia are essential for oocyte pickup but dispensable for sperm and embryo transport[J]. Proc Natl Acad Sci U S A, 2021, 118(22): e2102940118.
23	LOUKAS I, SKAMNELOU M, TSARIDOU S, et al. Fine-tuning multiciliated cell differentiation at the post-transcriptional level: contribution of miR-34/449 family members[J]. Biol Rev Camb Philos Soc, 2021, 96(5): 2321-2332.
24	MERCEY O, POPA A, CAVARD A, et al. Characterizing isomiR variants within the microRNA-34/449 family[J]. FEBS Lett, 2017, 591(5): 693-705.
25	LABIDI-GALY S I, PAPP E, HALLBERG D, et al. High grade serous ovarian carcinomas originate in the fallopian tube[J]. Nat Commun, 2017, 8(1): 1093.
26	PERETS R, WYANT G A, MUTO K W, et al. Transformation of the fallopian tube secretory epithelium leads to high-grade serous ovarian cancer in Brca;Tp53;Pten models[J]. Cancer Cell, 2013, 24(6): 751-765.
27	ISHIGURO T, OHATA H, SATO A, et al. Tumor-derived spheroids: relevance to cancer stem cells and clinical applications[J]. Cancer Sci, 2017, 108(3): 283-289.
28	ZHANG S, DOLGALEV I, ZHANG T, et al. Both fallopian tube and ovarian surface epithelium are cells-of-origin for high-grade serous ovarian carcinoma[J]. Nat Commun, 2019, 10(1): 5367.

[1]	ZHENG Xiaoyan, WANG Xingyun, ZHANG Yongjun. Improvement of alveolarization arrest in newborn rats with bronchopulmonary dysplasia via inhibiting alveolar epithelial cell pyroptosis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(2): 171-179.
[2]	XIE Lin, CHENG Ye, ZHENG Qimin, ZHANG Xi, FU Lili, CHEN Min, WANG Yi, MEI Changlin, XIE Jingyuan, GU Xiangchen. Preventive effect of icariin on transition from acute kidney injury to chronic kidney disease in mouse model [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(1): 8-19.
[3]	XIE Xinyi, YANG Yumeng, WANG Shaowei, SUN Na, SHI Chuandao, LIU Qiling, ZHANG Rongqiang, LI Junjie. Genomic regulatory network of human olfactory neuroepithelial cells infected with novel coronavirus (SARS-COV-2) [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(11): 1524-1533.
[4]	Tian-hao ZHOU, Zhao-chen XIN, Shao-qian DU, Yuan CAO, Jing-xuan XU, Zeng-hong LAO, Hong-xia WANG. Establishment and optimization of co-culture technology for breast cancer organoids [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 1017-1024.
[5]	WANG Yu-ting, LIU Jin-yan, SHI Ce, ZHAO Jun-tao, XIANG Ming-jie. Knocking out ERG3 gene of Candida albicans and its effect on drug resistance [J]. , 2020, 40(2): 163-.
[6]	WANG Ling-xiao, LIU Ting-ting, YANG Xiao-hui, YAO Zhi-qing, CAI Hui-zhen. Effect of Lycium barbarum polysaccharides on inflammatory cytokines in type 2 diabetes mellitus model mice without myeloid differentiation factor 88 gene [J]. , 2019, 39(2): 136-.
[7]	WANG Pei, XU Ting-ting, ZHAO Qing, WANG Zhen . Application and development of genetic knockout animal models in researches of obsessive-compulsive disorder#br# [J]. , 2017, 37(9): 1292-.
[8]	WANG Jian-ru, LIU Ping . Advances in differences between ApoE ^-/- and LDLR^-/- atherosclerotic model mice#br# [J]. , 2017, 37(7): 1033-.
[9]	LI Wen-jing, LIU Jin-yan, SHI Ce, et al. Knock out FLO8 gene in Candida albicans by fusion PCR combined with homologous recombination [J]. , 2016, 36(3): 334-.
[10]	YING Ji, LIU Jian, ZHANG Li-wen, ZHONG Fang, ZHOU Fang-fang, WANG Wei-ming. Generation and identification of renal tubular epithelial cell C/EBPα conditional knockout mice [J]. , 2016, 36(10): 1403-.
[11]	WANG Yu-xuan, GAN Hua. Effects of angiotensin Ⅱ on necroptosis of rat renal tubular epithelial cells [J]. , 2015, 35(6): 813-.
[12]	JIANG Shi-zhong, YAN Ya-bin, XIE Fei, et al. Model establishment of transgenic mouse mammary epithelial cells for research of gene expression [J]. , 2012, 32(7): 955-.
[13]	ZHENG Tao, YANG Zu-jing, QIAN Lin-xi. Mechanism of lactogenic effect of Medulla Tetrapanacis in lactation [J]. , 2012, 32(6): 689-.
[14]	WANG Luo-wen, DENG Lian-fu, ZHU Ya-ping, et al. Regulation of interaction of osteoblasts and osteoclasts by hypoxia/hypoxia-inducible factor-1&alpha\|pathway [J]. , 2012, 32(3): 274-.
[15]	LI Hong-li, DU Lian-fang, LI Feng-hua, et al. Effects of ultrasound exposure and sodium butyrate on transfection of adeno-associated virus to rat retinal pigment epithelial cells [J]. , 2012, 32(10): 1288-.