Microenvironmental profiles of wound tissues with accelerated healing properties by HAMA hydrogel

doi:10.3969/j.issn.1674-8115.2025.08.004

Abstract

Abstract:

Objective ·To explore the roles of hyaluronic acid methacryloyl (HAMA) hydrogel in skin wound healing and to characterize the microenvironmental landscape at wound sites. Methods ·A full-thickness skin excision model was established in mice, which were randomly divided into a control group (n=3) and a HAMA group (n=3). The wound in the HAMA and control groups were covered with 100 μL of HAMA hydrogel and 100 μL of phenyl-2,4,6-trimethylbenzoylphosphonic acid lithium (LAP), respectively. Both groups were then irradiated with a UV lamp for 20 s. The residual wound areas was measured on days 0, 3, 7, 10, and 14. Wound healing effects of HAMA hydrogel were analyzed by measuring the residual wound area and through H-E staining. Single-cell RNA sequencing technology was utilized to analyze the cellular profile of local wound skin tissues at day 14 post-injury. Immunofluorescence assay was used to detect the levels of type I collagen, type Ⅲ collagen, F4/80, CD206, and CD86 in the wound sites. The mRNA expression levels of Arg1, Nos2, Itgam, and Itgb2 in the mouse macrophage cell line Raw264.7 co-cultured with HAMA hydrogel for 24 h were detected by RT-qPCR. The fibroblasts and macrophages in the local skin of the mouse wound on day 14 were analyzed using the Seurat package, and the communication between fibroblasts and macrophages was analyzed using the CellChat package. Results ·Mice treated with HAMA hydrogel exhibited a significantly faster rate of wound healing process compared to the control group. At day 14, wounds in the HAMA-treated mice had already healed, while those in the control group remained unhealed. Single-cell RNA sequencing analysis revealed a remarkable increase in the proportion of fibroblasts in the skin tissues of HAMA-treated wounds. The proportion of the Col3a1-high-expressing fibroblast subset increased (90.2%) compared to the control group (79.8%), while the proportion of the Col1a1-high-expressing fibroblast subset decreased (5.7% vs 15.9%). Immunofluorescence analysis confirmed that the level of type Ⅲ collagen in the wound tissues of the HAMA group was significantly higher than that in the control group (P=0.035), while the level of type Ⅰ collagen was significantly lower (P=0.044). Although there was no significant difference in the proportions of macrophages in the wound tissues between the HAMA-treated and control groups, scRNA sequencing data and in vitro experiments using Raw264.7 cells showed that HAMA hydrogel could induce the expression of Arg1 and decrease the expression of Nos2 in the macrophages (P<0.001). Additionally, macrophages in the HAMA-treated wounds expressed higher levels of CD206 and lower levels of CD86 (P=0.042, P=0.011). The results of the CellChat analysis showed that, compared to the control group, increased communication intensity was observed between macrophages and fibroblasts subsets at the wound sites in the mice of HAMA group. Conclusion ·The microenvironment after HAMA hydrogel treatment is conducive to skin wound healing, characterized by a local aggregation of anti-inflammatory macrophages and fibroblasts that secrete type Ⅲ collagen.

Key words: wound healing, macrophages, fibroblasts, hyaluronic acid methacryloyl (HAMA), single-cell RNA transcriptome

CLC Number:

R641

JIANG Qianyu, YAO Chengcheng, JI Ping, WANG Ying. Microenvironmental profiles of wound tissues with accelerated healing properties by HAMA hydrogel[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(8): 969-980.

Figures/Tables 8

Tab 1 Primer sequences

Name	Forward (5'→3' )	Reverse (3'→5' )
Arg1	CTCCAAGCCAAAGTCCTTAGAG	AGGAGCTGTCATTAGGGACATC
Nos2	GTTCTCAGCCCAACAATACAAGA	GTGGACGGGTCGATGTCAC
Itgam	CCATGACCTTCCAAGAGAATGC	ACCGGCTTGTGCTGTAGTC
Itgb2	AGGAGCATCGCTAATCCTGAG	CCTGGTCGCAAGTAAAGTGTC
Gapdh	AGGTCGGTGTGAACGGATTTG	TGTAGACCATGTAGTTGAGGTCA

Fig 1 Promotive effects of HAMA hydrogel on wound healing

Fig 2 Single-Cell RNA sequencing analysis of cell composition at mouse skin wound sites

Fig 3 Analysis on composition and function of fibroblasts in wound sites

Fig 4 Analysis on composition and function of macrophages in wound sites

Fig 5 Effects of HAMA hydrogel on the expression of polarization-related genes in the macrophages

Fig 6 Analysis of local macrophage polarization characteristics in wound sites treated with HAMA hydrogel

Fig 7 Interaction patterns between fibroblasts and macrophages in wound tissues

TrendMD

References 39

[1]	MASCHALIDI S, MEHROTRA P, KEÇELI B N, et al. Targeting SLC7A11 improves efferocytosis by dendritic cells and wound healing in diabetes[J]. Nature, 2022, 606(7915): 776-784.
[2]	LU Y Z, NAYER B, SINGH S K, et al. CGRP sensory neurons promote tissue healing via neutrophils and macrophages[J]. Nature, 2024, 628(8008): 604-611.
[3]	GURTNER G C, WERNER S, BARRANDON Y, et al. Wound repair and regeneration[J]. Nature, 2008, 453(7193): 314-321.
[4]	FISCHER A, WANNEMACHER J, CHRIST S, et al. Neutrophils direct preexisting matrix to initiate repair in damaged tissues[J]. Nat Immunol, 2022, 23(4): 518-531.
[5]	GALLI S J, BORREGAARD N, WYNN T A. Phenotypic and functional plasticity of cells of innate immunity: macrophages, mast cells and neutrophils[J]. Nat Immunol, 2011, 12(11): 1035-1044.
[6]	SINHA S, SPARKS H D, LABIT E, et al. Fibroblast inflammatory priming determines regenerative versus fibrotic skin repair in reindeer[J]. Cell, 2022, 185(25): 4717-4736.e25.
[7]	JIANG D S, GUO R J, MACHENS H G, et al. Diversity of fibroblasts and their roles in wound healing[J]. Cold Spring Harb Perspect Biol, 2023, 15(3): a041222.
[8]	ZHAO L, FENG Z P, LYU Y, et al. Electroactive injectable hydrogel based on oxidized sodium alginate and carboxymethyl chitosan for wound healing[J]. Int J Biol Macromol, 2023, 230: 123231.
[9]	SETHI S, THAKUR S, SHARMA D, et al. Malic acid cross-linked chitosan based hydrogel for highly effective removal of chromium (Ⅵ) ions from aqueous environment[J]. React Funct Polym, 2022, 177: 105318.
[10]	HELMECKE T, HAHN D, MATZKE N, et al. Inflammation-controlled anti-inflammatory hydrogels[J]. Adv Sci (Weinh), 2023, 10(7): e2206412.
[11]	CHENG L, CAI Z W, YE T J, et al. Injectable polypeptide-protein hydrogels for promoting infected wound healing[J]. Adv Funct Materials, 2020, 30(25): 2001196.
[12]	XU Z, LIU G, LIU P, et al. Hyaluronic acid-based glucose-responsive antioxidant hydrogel platform for enhanced diabetic wound repair [J]. Acta Biomater, 2022, 147: 147-157.
[13]	HONG S, YANG K, KANG B, et al. Hyaluronic acid catechol: a biopolymer exhibiting a pH-dependent adhesive or cohesive property for human neural stem cell engineering[J]. Adv Funct Materials, 2013, 23(14): 1774-1780.
[14]	SINGH A, CORVELLI M, UNTERMAN S A, et al. Enhanced lubrication on tissue and biomaterial surfaces through peptide-mediated binding of hyaluronic acid[J]. Nat Mater, 2014, 13(10): 988-995.
[15]	CAI Z X, ZHANG H B, WEI Y, et al. Reduction- and pH-sensitive hyaluronan nanoparticles for delivery of iridium (Ⅲ) anticancer drugs[J]. Biomacromolecules, 2017, 18(7): 2102-2117.
[16]	SHU X Z, LIU Y C, LUO Y, et al. Disulfide cross-linked hyaluronan hydrogels[J]. Biomacromolecules, 2002, 3(6): 1304-1311.
[17]	SERBAN M A, PRESTWICH G D. Synthesis of hyaluronan haloacetates and biology of novel cross-linker-free synthetic extracellular matrix hydrogels[J]. Biomacromolecules, 2007, 8(9): 2821-2828.
[18]	LIU B, KONG Y F, ALIMI O A, et al. Multifunctional microgel-based cream hydrogels for postoperative abdominal adhesion prevention[J]. ACS Nano, 2023, 17(4): 3847-3864.
[19]	ZHOU K, YANG C L, SHI K, et al. Activated macrophage membrane-coated nanoparticles relieve osteoarthritis-induced synovitis and joint damage[J]. Biomaterials, 2023, 295: 122036.
[20]	LEE J, KIM D, JANG C H, et al. Highly elastic 3D-printed gelatin/HA/placental-extract scaffolds for bone tissue engineering[J]. Theranostics, 2022, 12(9): 4051-4066.
[21]	LIU N B, ZHU S J, DENG Y Z, et al. Construction of multifunctional hydrogel with metal-polyphenol capsules for infected full-thickness skin wound healing[J]. Bioact Mater, 2022, 24: 69-80.
[22]	FARAHANI M, SHAFIEE A. Wound healing: from passive to smart dressings[J]. Adv Healthc Mater, 2021, 10(16): e2100477.
[23]	GAO S Y, CHEN T, WANG Z, et al. Immuno-activated mesenchymal stem cell living electrospun nanofibers for promoting diabetic wound repair[J]. J Nanobiotechnology, 2022, 20(1): 294.
[24]	WANG X, ZHAO D H, LI Y T, et al. Collagen hydrogel with multiple antimicrobial mechanisms as anti-bacterial wound dressing[J]. Int J Biol Macromol, 2023, 232: 123413.
[25]	PENG Z W, XUE H, LIU X, et al. Tough, adhesive biomimetic hyaluronic acid methacryloyl hydrogels for effective wound healing[J]. Front Bioeng Biotechnol, 2023, 11: 1222088.
[26]	AHMED M K, ZAYED M A, EL-DEK S I, et al. Nanofibrous ε-polycaprolactone scaffolds containing Ag-doped magnetite nanoparticles: physicochemical characterization and biological testing for wound dressing applications in vitro and in vivo[J]. Bioact Mater, 2021, 6(7): 2070-2088.
[27]	YAMASAKI S, ISHIKAWA E, SAKUMA M, et al. Mincle is an ITAM-coupled activating receptor that senses damaged cells[J]. Nat Immunol, 2008, 9(10): 1179-1188.
[28]	CHEN J P, CHEN D F, CHEN J L, et al. An all-in-one CO gas therapy-based hydrogel dressing with sustained insulin release, anti-oxidative stress, antibacterial, and anti-inflammatory capabilities for infected diabetic wounds[J]. Acta Biomater, 2022, 146: 49-65.
[29]	FU Y J, SHI Y F, WANG L Y, et al. All-natural immunomodulatory bioadhesive hydrogel promotes angiogenesis and diabetic wound healing by regulating macrophage heterogeneity[J]. Adv Sci (Weinh), 2023, 10(13): e2206771.
[30]	PEÑA O A, MARTIN P. Cellular and molecular mechanisms of skin wound healing[J]. Nat Rev Mol Cell Biol, 2024, 25(8): 599-616.
[31]	HINZ B. Formation and function of the myofibroblast during tissue repair[J]. J Invest Dermatol, 2007, 127(3): 526-537.
[32]	WAN R, WEISSMAN J P, GRUNDMAN K, et al. Diabetic wound healing: the impact of diabetes on myofibroblast activity and its potential therapeutic treatments[J]. Wound Repair Regen, 2021, 29(4): 573-581.
[33]	YOUNESI F S, MILLER A E, BARKER T H, et al. Fibroblast and myofibroblast activation in normal tissue repair and fibrosis[J]. Nat Rev Mol Cell Biol, 2024, 25(8): 617-638.
[34]	MOTZ K, LINA I, MURPHY M K, et al. M2 macrophages promote collagen expression and synthesis in laryngotracheal stenosis fibroblasts[J]. Laryngoscope, 2021, 131(2): E346-E353.
[35]	HE J H, FANG B, SHAN S Z, et al. Mechanical stretch promotes hypertrophic scar formation through mechanically activated cation channel Piezo1[J]. Cell Death Dis, 2021, 12(3): 226.
[36]	LI S Y, LI C, ZHANG Y T, et al. Targeting mechanics-induced fibroblast activation through CD44-RhoA-YAP pathway ameliorates crystalline silica-induced silicosis[J]. Theranostics, 2019, 9(17): 4993-5008.
[37]	AMUSO V M, HAAS M R, COOPER P O, et al. Fibroblast-mediated macrophage recruitment supports acute wound healing[J]. J Investig Dermatol, 2025, 145(7): 1781-1797.e8.
[38]	SHEN L Y, LI Y S, ZHAO H K. Fibroblast growth factor signaling in macrophage polarization: impact on health and diseases[J]. Front Immunol, 2024, 15: 1390453.
[39]	CHEN C, YANG J C, SHANG R Y, et al. Orchestration of macrophage polarization dynamics by fibroblast-secreted exosomes during skin wound healing[J]. J Invest Dermatol, 2025, 145(1): 171-184.e6.