Ubiquitination and degradation of RPTPα mediated by MARCH9

doi:10.3969/j.issn.1674-8115.2025.08.003

Abstract

Abstract:

Objective ·To investigate the molecular mechanisms and biological functions of the E3 ubiquitin ligase membrane-associated RING-CH 9 (MARCH9) in regulating the ubiquitination of receptor protein tyrosine phosphatase alpha (RPTPα). Methods ·Western blotting was employed to identify the ubiquitination type of RPTPα and to evaluate the regulatory effect of MARCH9 on its ubiquitination level; Comparative analysis of RPTPα protein stability was performed among wild-type MARCH9, catalytically inactive MARCH9 mutants (MARCH9 S198A or MARCH9-HC/CC), and endogenous MARCH9 knockdown via shRNA. Proteasome inhibitor MG132, autophagy inhibitor 3-MA, and lysosomal inhibitor chloroquine (CQ) were used to determine the degradation pathway of MARCH9-mediated RPTPα ubiquitination. The mechanism underlying 43 ℃ heat shock-induced RPTPα degradation was explored. Stable lung cancer cell lines with MARCH9 single-knockdown (H1299-shMARCH9) and MARCH9/RPTPα double-knockdown (H1299-shMARCH9-shRPTPα) were established using lentiviral vectors. CCK-8 proliferation assay, colony formation assay, and soft agar assay were conducted to evaluate the effects of MARCH9 or RPTPα on lung cancer cell proliferation and clonogenicity. Vasculogenic mimicry formation assay and scratch wound healing assay were performed to assess the impacts on tumor cell invasion and migration. Subcutaneous xenograft models in nude mice were established to examine in vivo tumorigenicity. Bioinformatics analysis was used to compare the expression differences and prognostic correlations of MARCH9 and RPTPα in lung cancer patients. Results ·RPTPα predominantly underwent K63-linked poly-ubiquitination, which was significantly enhanced by MARCH9 overexpression. Wild-type MARCH9, but not its catalytic mutants, markedly reduced RPTPα protein stability, while endogenous MARCH9 knockdown increased RPTPα levels. CQ, not MG132 or 3-MA, restored RPTPα stability, indicating that MARCH9 mediated lysosomal degradation of RPTPα through ubiquitination. Heat shock at 43 ℃ specifically enhanced MARCH9-RPTPα interaction, promoting RPTPα degradation. Functional assays revealed that, compared to control H1299 cells, MARCH9-knockdown cells exhibited elevated RPTPα levels, accelerated proliferation, enhanced clonogenicity and invasive capacity, and increased tumorigenicity in nude mice. These phenotypes could be reversed by double knockdown of MARCH9/RPTPα. Bioinformatics analysis demonstrated that high RPTPα expression correlated with poor prognosis and tumor metastasis in lung cancer patients, while MARCH9 showed inverse correlations. Conclusion ·MARCH9 mediates K63-linked ubiquitination-dependent lysosomal degradation of phosphatase RPTPα, providing new insights into developing RPTPα-targeted cancer therapeutic strategies.

Key words: protein tyrosine phosphatase RPTPα, E3 ubiquitin ligase MARCH9, ubiquitination, heat shock, lung cancer

CLC Number:

R734.2

ZHANG Yuqin, AIHEMAITI Yilixiati, WANG Yanli, YANG Zhi, HUANG Jian. Ubiquitination and degradation of RPTPα mediated by MARCH9[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(8): 957-968.

Figures/Tables 8

TrendMD

References 23

[1]	SAP J, D'EUSTACHIO P, GIVOL D, et al. Cloning and expression of a widely expressed receptor tyrosine phosphatase[J]. Proc Natl Acad Sci USA, 1990, 87(16): 6112-6116.
[2]	ZHENG X M, WANG Y, FALLEN C J. Cell transformation and activation of pp60c-src by overexpression of a protein tyrosine phosphatase[J]. Nature, 1992, 359(6393): 336-339.
[3]	ZHENG X M, RESNICK R J, SHALLOWAY D. A phosphotyrosine displacement mechanism for activation of Src by PTPα[J]. EMBO J, 2000, 19(5): 964-978.
[4]	VACARU A M, DEN HERTOG J. Serine dephosphorylation of receptor protein tyrosine phosphatase α in mitosis induces Src binding and activation[J]. Mol Cell Biol, 2010, 30(12): 2850-2861.
[5]	PALLEN C J. Protein tyrosine phosphatase alpha (PTPα): a Src family kinase activator and mediator of multiple biological effects[J]. Curr Top Med Chem, 2003, 3(7): 821-835.
[6]	TABITI K, SMITH D R, GOH H S, et al. Increased mRNA expression of the receptor-like protein tyrosine phosphatase α in late stage colon carcinomas[J]. Cancer Lett, 1995, 93(2): 239-248.
[7]	BERNDT A, LUO X, BÖHMER F D, et al. Expression of the transmembrane protein tyrosine phosphatase RPTPα in human oral squamous cell carcinoma[J]. Histochem Cell Biol, 1999, 111(5): 399-403.
[8]	KRNDIJA D, SCHMID H, EISMANN J L, et al. Substrate stiffness and the receptor-type tyrosine-protein phosphatase α regulate spreading of colon cancer cells through cytoskeletal contractility[J]. Oncogene, 2010, 29(18): 2724-2738.
[9]	ARDINI E, AGRESTI R, TAGLIABUE E, et al. Expression of protein tyrosine phosphatase α (RPTPα) in human breast cancer correlates with low tumor grade, and inhibits tumor cell growth in vitro and in vivo[J]. Oncogene, 2000, 19(43): 4979-4987.
[10]	ZHENG X M, RESNICK R J, SHALLOWAY D. Apoptosis of estrogen-receptor negative breast cancer and colon cancer cell lines by PTPα and Src RNAi[J]. Int J Cancer, 2008, 122(9): 1999-2007.
[11]	ANDERSON K S, CRAMER D W, SIBANI S, et al. Autoantibody signature for the serologic detection of ovarian cancer[J]. J Proteome Res, 2015, 14(1): 578-586.
[12]	FANG J Y, ZHANG Y Q, HUANG C H, et al. Glucose-mediated N-glycosylation of RPTPα affects its subcellular localization and Src activation[J]. Oncogene, 2023, 42(14): 1058-1071.
[13]	RAIBORG C, STENMARK H. The ESCRT machinery in endosomal sorting of ubiquitylated membrane proteins[J]. Nature, 2009, 458(7237): 445-452.
[14]	LIN H, LI S, SHU H B. The membrane-associated MARCH E3 ligase family: emerging roles in immune regulation[J]. Front Immunol, 2019, 10: 1751.
[15]	HÖR S, ZIV T, ADMON A, et al. Stable isotope labeling by amino acids in cell culture and differential plasma membrane proteome quantitation identify new substrates for the MARCH9 transmembrane E3 ligase[J]. Mol Cell Proteomics, 2009, 8(8): 1959-1971.
[16]	LUO Q, LIU Q Q, CHENG H C, et al. Nondegradable ubiquitinated ATG9A organizes Golgi integrity and dynamics upon stresses[J]. Cell Rep, 2022, 40(7): 111195.
[17]	TAN C, BYRNE E F X, AH-CANN C, et al. A serine in the first transmembrane domain of the human E3 ubiquitin ligase MARCH9 is critical for down-regulation of its protein substrates[J]. J Biol Chem, 2019, 294(7): 2470-2485.
[18]	HAGLUND K, DIKIC I. The role of ubiquitylation in receptor endocytosis and endosomal sorting[J]. J Cell Sci, 2012, 125(Pt 2): 265-275.
[19]	HUANG F T, KIRKPATRICK D, JIANG X J, et al. Differential regulation of EGF receptor internalization and degradation by multiubiquitination within the kinase domain[J]. Mol Cell, 2006, 21(6): 737-748.
[20]	LIU H, CHEN B, LIU L L, et al. The role of MARCH9 in colorectal cancer progression[J]. Front Oncol, 2022, 12: 906897.
[21]	SHEN Q M, WANG H Y, XU S. MARCH9 suppresses lung adenocarcinoma progression by downregulating ICAM-1[J]. Cell Physiol Biochem, 2018, 50(1): 92-107.
[22]	LUO M, MENG Z P, MOROISHI T, et al. Heat stress activates YAP/TAZ to induce the heat shock transcriptome[J]. Nat Cell Biol, 2020, 22(12): 1447-1459.
[23]	NICE T J, DENG W W, COSCOY L, et al. Stress-regulated targeting of the NKG2D ligand Mult1 by a membrane-associated RING-CH family E3 ligase[J]. J Immunol, 2010, 185(9): 5369-5376.

Primer	Forword (5′→3′)	Reverse (5′→3′)
MARCH9-HA	CGCGGATCCGCCACCATGCTCAAGTCTCG GCTCCGCA	CCGGAATTCTCAAGCGTAGTCTGGGACGTCG TATGGGTAGACTGTAGTGACCCTCATGACA
MARCH9-H136A/C139S	TCAGCCCAGCCTCATCCGCTGGAT	GCCGTGCAGCGCACTGAGCCGT
MARCH9-CC152/155SS	TCAGCTACTTCAAGTACCAGGTCCTGGC	GCTCACTGCTCCAGGAGCCCCTCTCG
MARCH9-S198A	GCCATCTCCTGGCTCATCTGGTCCT	GGCAACCAGGAAGAGCGAGCCCAGA

Primer	Forword (5′→3′)	Reverse (5′→3′)
MARCH9-HA	CGCGGATCCGCCACCATGCTCAAGTCTCG GCTCCGCA	CCGGAATTCTCAAGCGTAGTCTGGGACGTCG TATGGGTAGACTGTAGTGACCCTCATGACA
MARCH9-H136A/C139S	TCAGCCCAGCCTCATCCGCTGGAT	GCCGTGCAGCGCACTGAGCCGT
MARCH9-CC152/155SS	TCAGCTACTTCAAGTACCAGGTCCTGGC	GCTCACTGCTCCAGGAGCCCCTCTCG
MARCH9-S198A	GCCATCTCCTGGCTCATCTGGTCCT	GGCAACCAGGAAGAGCGAGCCCAGA

Name	Sequence (5'→3')
MARCH9 shRNA1	CCGGGTCCAGATTGCTGCCATAGTTCTCGAGAACTATGGCAGCAATCTGGACTTTTTG
MARCH9 shRNA2	CCGGGCAGTGGAAGGTCCTAAATTACTCGAGTAATTTAGGACCTTCCACTGCTTTTTG
MARCH9 shRNA3	CCGGCCCTGGAGAGAACCGTCTTTACTCGAGTAAAGACGGTTCTCTCCAGGGTTTTTG

Name	Sequence (5'→3')
MARCH9 shRNA1	CCGGGTCCAGATTGCTGCCATAGTTCTCGAGAACTATGGCAGCAATCTGGACTTTTTG
MARCH9 shRNA2	CCGGGCAGTGGAAGGTCCTAAATTACTCGAGTAATTTAGGACCTTCCACTGCTTTTTG
MARCH9 shRNA3	CCGGCCCTGGAGAGAACCGTCTTTACTCGAGTAAAGACGGTTCTCTCCAGGGTTTTTG