Levels of adiponectin in the peripheral blood of patients with immune thrombocytopenia and its effect on the differentiation of megakaryocyte cell line

doi:10.3969/j.issn.1674-8115.2022.07.004

Abstract

Abstract: Objective

·To explore the level of adiponectin in the peripheral blood plasma of patients with immune thrombocytopenia (ITP) and its effect on the differentiation and maturation of megakaryocytes.

Methods

·From January 2021 to February 2022, the peripheral blood samples were collected from 46 ITP patients in the Department of Hematology, The First Affiliated Hospital of Soochow University and 30 healthy controls with corresponding gender and age in the physical examination center. The plasma adiponectin levels in the ITP patients and healthy control (HC) group were detected by using human adiponectin enzyme-linked immunosorbent assay (ELISA) kits. And the correlation between adiponectin level and body mass index (BMI) in the ITP patients was analyzed. In terms of cell experiments, real-time quantitative PCR (RT-qPCR) and Western blotting were used to study the expression of adiponectin receptors (ADIPOR1 and ADIPOR2) in the myeloid cell line K562, and the megakaryocyte cell lines MEG-01 and Dami at mRNA and protein levels, respectively. The differentiation of K562 cell line and the maturation of MEG-01 and Dami cell lines were induced by phorbol 12-myristate 13-acetate (PMA). At the same time, the cells were treated with different concentrations of adiponectin receptor agonist AdipoRon. Flow cytometry was used to detect the percentage of CD41⁺ cells, the mean fluorescence intensity (MFI) of CD41, and the proportion of polyploid cells (≥4N).

Results

·Compared with the HC group, the plasma adiponectin level of the ITP patients significantly increased (P=0.000), and there was no significant correlation between the adiponectin level and the BMI of the patients (P=0.621). RT-qPCR and Western blotting showed that ADIPOR1 and ADIPOR2 were expressed in K562, MEG-01 and Dami cell lines. The proportion of CD41⁺ cells in the K562 cell line co-cultured with 10 μmol/L or 20 μmol/L AdipoRon and PMA for 72 h were significantly lower than those in the PMA+DMSO group (P=0.000). The CD41-MFI (P=0.047) and the proportion of polyploid cells (P=0.003) in the MEG-01 cell line co-cultured with 20 μmol/L AdipoRon and PMA for 72 h were significantly higher than those in the PMA+DMSO group; however, in the Dami cell line, no significant increases of both were found after the treatment of 20 μmol/L AdipoRon and PMA.

Conclusion

·The adiponectin level is elevated in the peripheral blood plasma of ITP patients. Human myeloid cell line K562, and megakaryocyte cell lines MEG-01 and Dami all express adiponectin receptors ADIPOR1 and ADIPOR2. Adiponectin receptor agonists can inhibit megakaryocyte differentiation in vitro, but its effect on megakaryocyte maturation is uncertain.

Key words: immune thrombocytopenia (ITP), adiponectin, adiponectin receptor (ADIPOR), megakaryocyte, adipocytokine

CLC Number:

R558⁺.2

LI Xinyu, ZUO Bin, WANG Wen, NIU Xiaoyin, WENG Zhen, HE Yang. Levels of adiponectin in the peripheral blood of patients with immune thrombocytopenia and its effect on the differentiation of megakaryocyte cell line[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(7): 866-874.

Figures/Tables 9

TrendMD

References 26

1	RODEGHIERO F, STASI R, GERNSHEIMER T, et al. Standardization of terminology, definitions and outcome criteria in immune thrombocytopenic purpura of adults and children: report from an international working group[J]. Blood, 2009, 113(11): 2386-2393.
2	ZUFFEREY A, KAPUR R, SEMPLE J W. Pathogenesis and therapeutic mechanisms in immune thrombocytopenia (ITP)[J]. J Clin Med, 2017, 6(2): 16.
3	GHALLOUSSI D, DHENGE A, BERGMEIER W. New insights into cytoskeletal remodeling during platelet production[J]. J Thromb Haemost, 2019, 17(9): 1430-1439.
4	LI Q W, WU Y S, KANG N. Marrow adipose tissue: its origin, function, and regulation in bone remodeling and regeneration[J]. Stem Cells Int, 2018, 2018: 7098456.
5	YANAI H, YOSHIDA H. Beneficial effects of adiponectin on glucose and lipid metabolism and atherosclerotic progression: mechanisms and perspectives[J]. Int J Mol Sci, 2019, 20(5): 1190.
6	DIMASCIO L, VOERMANS C, UQOEZWA M, et al. Identification of adiponectin as a novel hemopoietic stem cell growth factor[J]. J Immunol, 2007, 178(6): 3511-3520.
7	NEUNERT C, TERRELL D R, ARNOLD D M, et al. American Society of Hematology 2019 guidelines for immune thrombocytopenia[J]. Blood Adv, 2019, 3(23): 3829-3866.
8	中华医学会血液学分会血栓与止血学组. 成人原发免疫性血小板减少症诊断与治疗中国指南(2020年版)[J]. 中华血液学杂志, 2020, 41(8): 617-623.
	Thrombosis and Hemostasis Group, Chinese Society of Hematology. Chinese guidelines for the diagnosis and treatment of adult primary immune thrombocytopenia (2020 edition)[J]. Chin J Hematol, 2020, 41(8): 617-623.
9	ALITALO R. Induced differentiation of K562 leukemia cells: a model for studies of gene expression in early megakaryoblasts[J]. Leuk Res, 1990, 14(6): 501-514.
10	KONG X Z, YIN R H, NING H M, et al. Effects of THAP11 on erythroid differentiation and megakaryocytic differentiation of K562 cells[J]. PLoS One, 2014, 9(3): e91557.
11	QU M Y, ZOU X J, FANG F, et al. Platelet-derived microparticles enhance megakaryocyte differentiation and platelet generation via miR-1915-3p[J]. Nat Commun, 2020, 11(1): 4964.
12	ISAKARI Y, SOGO S, ISHIDA T, et al. Gene expression analysis during platelet-like particle production in phorbol myristate acetate-treated MEG-01 cells[J]. Biol Pharm Bull, 2009, 32(3): 354-358.
13	MA D C, YU H Y, LIN D, et al. S6K1 is involved in polyploidization through its phosphorylation at Thr421/Ser424[J]. J Cell Physiol, 2009, 219(1): 31-44.
14	MIYASHITA N, ONOZAWA M, YOKOYAMA S, et al. Anagrelide modulates proplatelet formation resulting in decreased number and increased size of platelets[J]. HemaSphere, 2019, 3(4): e268.
15	WILHIDE C C, VAN DANG C, DIPERSIO J, et al. Overexpression of cyclin D1 in the Dami megakaryocytic cell line causes growth arrest[J]. Blood, 1995, 86(1): 294-304.
16	NIELSEN M B, ÇOLAK Y, BENN M, et al. Causal relationship between plasma adiponectin and body mass index: one- and two-sample bidirectional Mendelian randomization analyses in 460 397 individuals[J]. Clin Chem, 2020, 66(12): 1548-1557.
17	TAKAHATA C, MIYOSHI Y, IRAHARA N, et al. Demonstration of adiponectin receptors 1 and 2 mRNA expression in human breast cancer cells[J]. Cancer Lett, 2007, 250(2): 229-236.
18	BRIGHTON T A, EVANS S, CASTALDI P A, et al. Prospective evaluation of the clinical usefulness of an antigen-specific assay (MAIPA) in idiopathic thrombocytopenic purpura and other immune thrombocytopenias[J]. Blood, 1996, 88(1): 194-201.
19	MCMILLAN R, WANG L, TANI P. Prospective evaluation of the immunobead assay for the diagnosis of adult chronic immune thrombocytopenic purpura (ITP)[J]. J Thromb Haemost, 2003, 1(3): 485-491.
20	WARNER M N, MOORE J C, WARKENTIN T E, et al. A prospective study of protein-specific assays used to investigate idiopathic thrombocytopenic purpura[J]. Br J Haematol, 1999, 104(3): 442-447.
21	CHEN S L, HU M J, SHEN M Q, et al. IGF-1 facilitates thrombopoiesis primarily through Akt activation[J]. Blood, 2018, 132(2): 210-222.
22	GAINSFORD T, ROBERTS A W, KIMURA S, et al. Cytokine production and function in c-mpl-deficient mice: no physiologic role for interleukin-3 in residual megakaryocyte and platelet production[J]. Blood, 1998, 91(8): 2745-2752.
23	KUO S M, HALPERN M M. Lack of association between body mass index and plasma adiponectin levels in healthy adults[J]. Int J Obes (Lond), 2011, 35(12): 1487-1494.
24	CHANG M, NAKAGAWA P A, WILLIAMS S A, et al. Immune thrombocytopenic purpura (ITP) plasma and purified ITP monoclonal autoantibodies inhibit megakaryocytopoiesis in vitro[J]. Blood, 2003, 102(3): 887-895.
25	MCMILLAN R, WANG L, TOMER A, et al. Suppression of in vitro megakaryocyte production by antiplatelet autoantibodies from adult patients with chronic ITP[J]. Blood, 2004, 103(4): 1364-1369.
26	YANG L, WANG L, ZHAO C H, et al. Contributions of TRAIL-mediated megakaryocyte apoptosis to impaired megakaryocyte and platelet production in immune thrombocytopenia[J]. Blood, 2010, 116(20): 4307-4316.

Gene	Forward primer	Reverse primer
ADIPOR1	CCAACTGGATGGTACACGAAG	TGGGAAGATAGAACAGATGCCTC
ADIPOR2	CGGTTTGCCACTCCTAAGC	CCACTCAAGCCAAGTCCCA
GAPDH	GTGAAGGTCGGAGTCAACGG	GTTCTCAGCCTTGACGGTGC

Gene	Forward primer	Reverse primer
ADIPOR1	CCAACTGGATGGTACACGAAG	TGGGAAGATAGAACAGATGCCTC
ADIPOR2	CGGTTTGCCACTCCTAAGC	CCACTCAAGCCAAGTCCCA
GAPDH	GTGAAGGTCGGAGTCAACGG	GTTCTCAGCCTTGACGGTGC

Item	ITP patient （n=46）	HC （n=30）	P value
Gender （female/male）/n	15/31	17/13	0.057
Age/year	48.5 （15‒81）	48 （25‒77）	0.510
BMI/（kg·m^-2）	24.05 （21.81， 25.79）	23.71 （22.44， 25.11）	0.761
Platelet count/（×10⁹ L^-1）	32.0 （13.0， 69.3）	220.5 （190.8， 260.5）	0.000
Disease subtype/n （%）			‒
Newly diagnosed	15 （32.6）	‒
Persistent	8 （17.4）	‒
Chronic	23 （50.0）	‒
rPLT/%^①	20.60 （8.80， 27.70）	‒	‒
PAIgG/%^②	37.45 （32.18， 47.45）	‒	‒
Platelet autoantibodies detected by MAIPA/n （%）^③			‒
Positive	9 （31.03）	‒
Negative	20 （68.97）	‒
TPO/（pg·mL^-1）^④	117.9 （48.88， 185.9）	‒	‒

Item	ITP patient （n=46）	HC （n=30）	P value
Gender （female/male）/n	15/31	17/13	0.057
Age/year	48.5 （15‒81）	48 （25‒77）	0.510
BMI/（kg·m^-2）	24.05 （21.81， 25.79）	23.71 （22.44， 25.11）	0.761
Platelet count/（×10⁹ L^-1）	32.0 （13.0， 69.3）	220.5 （190.8， 260.5）	0.000
Disease subtype/n （%）			‒
Newly diagnosed	15 （32.6）	‒
Persistent	8 （17.4）	‒
Chronic	23 （50.0）	‒
rPLT/%^①	20.60 （8.80， 27.70）	‒	‒
PAIgG/%^②	37.45 （32.18， 47.45）	‒	‒
Platelet autoantibodies detected by MAIPA/n （%）^③			‒
Positive	9 （31.03）	‒
Negative	20 （68.97）	‒
TPO/（pg·mL^-1）^④	117.9 （48.88， 185.9）	‒	‒

[1]	WANG Xinpeng, WANG Junying, CAI Jiayi, FU Wanbing, ZHONG Hua. Effect of low-dose decitabine on the biological behavior of bone marrow mesenchymal stem cells derived from patients with immune thrombocytopenia [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(6): 758-767.
[2]	WANG Jun-ying1, LI Xin1, YIN Ting-yu2, LIU Jia2, WANG Xiao-dong3, ZHONG Hua1. Effects of bone marrow mesenchymal cells immune thrombocytopenia patients on the biological behaviors of megakaryocytes [J]. , 2018, 38(6): 616-.
[3]	LI Wei-hong, QI Hong-bo. Effect of recombinant adiponectin on pregnancy outcome in spontaneous abortion model mice#br# [J]. , 2018, 38(2): 142-.
[4]	YING Chen1, LIU Cai-hong2, HU Jia-an2, JIANG Shi-hu3, XU Zhi-hong2, SUN Jing2. Research on level of serum lipid metabolism related hormones in patients of obstructive sleep apnoea hypoxia syndrome combine with non-alcoholic fatty liver disease [J]. , 2018, 38(10): 1203-.
[5]	LIANG Wei, TIAN Shu-ya, REN Yan, SHEN Lin-hui . Serum CTRP1 level and its relationship with serum adiponectin level in elderly male metabolic syndrome patients [J]. , 2017, 37(2): 218-.
[6]	FU Shi, ZHOU Juan, WANG Zhong . Research progresses on the role of adiponectin and its receptors in prostate cancer#br# [J]. , 2017, 37(10): 1434-.
[7]	FU Zong-jie, LIN Yuan, MIAO Jie, YANG Guo-yuan, SHEN Lin-hui. Effects of adiponectin on the proliferation and apoptosis of mesenchymal stem cells [J]. , 2016, 36(5): 631-.
[8]	CHEN Cui, SHEN E. Research progresses of APPL1 and its role in cardiovascular diseases [J]. , 2016, 36(11): 1672-.
[9]	LI Wei-hong, MOU Xiao-ling. Effects of adiponectin on populations of peripheral blood Th17/Treg cells and cytokine levels of patients with unexplained recurrent spontaneous abortion [J]. , 2015, 35(7): 1004-.
[10]	CHEN Zhe, YANG Qian, CHEN Ting, et al. Effects of chronic sleep deprivation on expression of adipocytokine of young rats [J]. , 2015, 35(4): 614-.
[11]	LIN Ning, ZHANG Zhu-hua, LI Xiao-yong, et al. Effects of hypoxia induced by CoCl2 on expression of adiponectin in 3T3-L1 adipocytes [J]. , 2014, 34(4): 464-.
[12]	CHEN Ting, ZHANG Ze-yu, CHEN Zhe, et al. Research progress of relationship between obesity and adipocytokine secretion disorder induced by short sleep duration [J]. , 2013, 33(3): 359-.
[13]	BAI Yu-na, ZHENG Jia, SONG Zhen-feng, et al. Effect of curcumin on expression of adiponectin in mice with insulin resistance [J]. , 2013, 33(2): 136-.
[14]	YANG Lin, CHEN Jian-hua, XU Yi-feng. Impact of atypical antipsychotics on adiponectin [J]. , 2013, 33(2): 231-.
[15]	GUO Zhu-ying, WANG Shi-ting, XU Mang-hua, et al. Expressions of adiponectin receptors in lung tissue of type 1 and type 2 diabetic rats [J]. , 2013, 33(11): 1449-.