Therapeutic effect of artesunate on spontaneous mouse models of Sjögren syndrome (NOD/Ltj mouse)

doi:10.3969/j.issn.1674-8115.2025.10.003

Abstract

Abstract:

Objective ·To elevate the therapeutic effect of artesunate (ART) on NOD/Ltj mice (non-obese diabetic mice, the spontaneous models of Sjögren syndrome), and explore its potential impact on the distribution of B lymphocyte subsets. Methods ·ICR mice were used as the blank control group, and NOD/Ltj mice were randomly divided into disease and ART groups. NOD/Ltj mice and ICR mice were treated with ART (10 mg/ kg) or its vehicle (0.5%CMC) by oral gavage every other day for 4 weeks. Body weight, salivary flow rate, submandibular gland index, and spleen index were measured. Cytokines in plasma, including interleukin-6 (IL-6), interferon-γ (IFN-γ), and B-cell activating factor (BAFF) in serum, were detected by cytometric bead array (CBA). Hematoxylin-Eosin (H-E) staining of submandibular glands was used to observe the infiltration of lymphocyte. Flow cytometry was applied to analyze the distribution of B lymphocyte subsets in the spleen. The mRNA expression of Prdm1, Il-6r, Il-6, and Stat3 in spleen B lymphocytes was detected by RT-qPCR. The effect of ART on B cells was further detected by CCK-8 and Annexin V-FITC/PI staining by flow cytometry. Results ·Compared to the disease group, ART significantly improved the symptoms of Sjögren syndrome in NOD/Ltj mice. ART treatment also resulted in a reduction in the levels of BAFF, IL-6, and IFN-γ in the plasma (all P<0.05). Moreover, lymphocyte infiltration around the glandular ducts in the submandibular glands was greatly improved in the ART group compared with the disease group. Flow cytometry analysis revealed that the proportion of Naïve B cells in the ART group was significantly increased compared with the disease group, along with a significant reduction in the proportions of double-negative B cells, switched memory B cells, and plasmablasts (all P<0.05). The relative mRNA expression levels of Prdm1, Il-6r,and Stat3 in the ART group were significantly lower than those in the disease group (all P<0.05). The CCK8 assay results showed that after 6 h of treatment, with the extension of the culture time, cell proliferation in the ART group was significantly inhibited; after 24 h of treatment, the number of apoptotic cells in the ART group was significantly higher than that in the control group (P<0.001). Conclusion ·ART demonstrates therapeutic effects in NOD/Ltj mice, potentially through modulating the distribution of peripheral B lymphocyte subsets. It can inhibit the expression of Prdm1, thereby regulating the differentiation of B lymphocytes into plasma cells and plasmablasts.

Key words: Sj?gren syndrome (SS), artesunate (ART), NOD/Ltj mouse, B lymphocyte

CLC Number:

R782.2

LI Yanxiang, SHI Huan, YU Chuangqi. Therapeutic effect of artesunate on spontaneous mouse models of Sjögren syndrome (NOD/Ltj mouse)[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(10): 1279-1287.

Figures/Tables 6

Tab 1 Primer sequences for qRT-PCR

Primer	Sequence (5'→3')
Prdm1-Forward	CTTCTCTTGGAAAAACGTGTGGG
Prdm1-Reverse	TCATATCAGCGTCCTCCATGT
Stat3-Forward	GAGAGCAGAAGGGAGCAA
Stat3-Reverse	CTCACAGAGTGGGGCAA
Il-6r-Forward	TTGGGTTGCTTCTCTGTGT
Il-6r-Reverse	AAGGTCGGCTTCAGTGG
Il-6-Forward	GTATGAACAACGATGATGCAC
Il-6-Reverse	CTCCAGAAGACCAGAGGAAA

Fig 1 Sjögren syndrome-like symptoms and pro-inflammatory cytokine levels in the plasma of mice (n=3)

Fig 2 Effect of ART on local lymphocytic infiltration in the submandibular glands of NOD/Ltj mice (n=3)

Fig 3 Effect of ART on the distribution of splenic B-lymphocyte subsets in NOD/Ltj mice

Fig 4 mRNA expression levels of Prdm1 (A), Il-6r (B), Stat3 (C), and Il-6 (D) in splenic B lymphocytes

Fig 5 Inductive effect of ART on apoptosis in Raji B lymphocytes

TrendMD

References 28

[1]	BALDINI C, FULVIO G, LA ROCCA G, et al. Update on the pathophysiology and treatment of primary Sjögren syndrome [J]. Nat Rev Rheumatol, 2024, 20(8): 473-491.
[2]	NOCTURNE G, MARIETTE X. B cells in the pathogenesis of primary Sjögren syndrome[J]. Nat Rev Rheumatol, 2018, 14(3): 133-145.
[3]	RAMOS-CASALS M, BRITO-ZERÓN P, BOMBARDIERI S, et al. EULAR recommendations for the management of Sjögren's syndrome with topical and systemic therapies[J]. Ann Rheum Dis, 2020, 79(1): 3-18.
[4]	PONTARINI E, SCIACCA E, CHOWDHURY F, et al. Serum and tissue biomarkers associated with composite of relevant endpoints for sjögren syndrome (CRESS) and sjögren tool for assessing response (STAR) to B cell-targeted therapy in the trial of anti-B cell therapy in patients with primary sjögren syndrome (TRACTISS)[J]. Arthritis Rheumatol, 2024, 76(5): 763-776.
[5]	BROWN S, COY N N, PITZALIS C, et al. The TRACTISS protocol: a randomised double blind placebo controlled clinical trial of anti-B-cell therapy in patients with primary Sjögren's Syndrome[J]. BMC Musculoskelet Disord, 2014, 15: 21.
[6]	WEI S J, HE Q M, ZHANG Q, et al. Traditional Chinese medicine is a useful and promising alternative strategy for treatment of Sjogren's syndrome: a review[J]. J Integr Med, 2021, 19(3): 191-202.
[7]	EFFERTH T, OESCH F. The immunosuppressive activity of artemisinin-type drugs towards inflammatory and autoimmune diseases[J]. Med Res Rev, 2021, 41(6): 3023-3061.
[8]	GAO X, LIN X, WANG Q W, et al. Artemisinins: promising drug candidates for the treatment of autoimmune diseases[J]. Med Res Rev, 2024, 44(2): 867-891.
[9]	HOU L F, BLOCK K E, HUANG H C. Artesunate abolishes germinal center B cells and inhibits autoimmune arthritis[J]. PLoS One, 2014, 9(8): e104762.
[10]	XIAO F, RUI K, HAN M, et al. Artesunate suppresses Th17 response via inhibiting IRF4-mediated glycolysis and ameliorates Sjog̈ren's syndrome[J]. Signal Transduct Target Ther, 2022, 7(1): 274.
[11]	ZHOU P P, HUANG M X, HANG Y, et al. Artesunate alleviates Sjögren's Syndrome by inhibiting the interferon-α signaling in plasmacytoid dendritic cells via TLR-MyD88-IRF7[J]. Biomed Pharmacother, 2024, 177: 116885.
[12]	MALONE M K, UJAS T A, COTTER K M, et al. FACS to identify immune subsets in mouse brain and spleen[J]. Methods Mol Biol, 2023, 2616: 213-229.
[13]	GU F, XU S X, ZHANG P Y, et al. CP-25 alleviates experimental sjögren's syndrome features in NOD/ltj mice and modulates T lymphocyte subsets[J]. Basic Clin Pharmacol Toxicol, 2018, 123(4): 423-434.
[14]	ZHAN T L, WANG B L, FU J Y, et al. Artesunate inhibits Sjögren's syndrome-like autoimmune responses and BAFF-induced B cell hyperactivation via TRAF6-mediated NF-κB signaling[J]. Phytomedicine, 2021, 80: 153381.
[15]	DIEHL S A, SCHMIDLIN H, NAGASAWA M, et al. IL-6 triggers IL-21 production by human CD4⁺ T cells to drive STAT3-dependent plasma cell differentiation in B cells[J]. Immunol Cell Biol, 2012, 90(8): 802-811.
[16]	FIKE A J, CHODISETTI S B, WRIGHT N E, et al. STAT3 signaling in B cells controls germinal center zone organization and recycling[J]. Cell Rep, 2023, 42(5): 112512.
[17]	MIELLE J, TISON A, CORNEC D, et al. B cells in sjögren's syndrome: from pathophysiology to therapeutic target[J]. Rheumatology (Oxford), 2021, 60(6): 2545-2560.
[18]	MINGUENEAU M, BOUDAOUD S, HASKETT S, et al. Cytometry by time-of-flight immunophenotyping identifies a blood Sjögren's signature correlating with disease activity and glandular inflammation[J]. J Allergy Clin Immunol, 2016, 137(6): 1809-1821.e12.
[19]	SZABÓ K, JÁMBOR I, SZÁNTÓ A, et al. The imbalance of circulating follicular T helper cell subsets in primary sjögren's syndrome associates with serological alterations and abnormal B-cell distribution[J]. Front Immunol, 2021, 12: 639975.
[20]	STEINMETZ T D, VERSTAPPEN G M, SUURMOND J, et al. Targeting plasma cells in systemic autoimmune rheumatic diseases: promises and pitfalls[J]. Immunol Lett, 2023, 260: 44-57.
[21]	DANG W Z, LI H, JIANG B, et al. Therapeutic effects of artesunate on lupus-prone MRL/lpr mice are dependent on T follicular helper cell differentiation and activation of JAK2-STAT3 signaling pathway[J]. Phytomedicine, 2019, 62: 152965.
[22]	THOMÉ R, DE CARVALHO A C, ALVES DA COSTA T, et al. Artesunate ameliorates experimental autoimmune encephalomyelitis by inhibiting leukocyte migration to the central nervous system[J]. CNS Neurosci Ther, 2016, 22(8): 707-714.
[23]	PINTO T N C, BENARD G, FERNANDES J R. Phenotypic characterization of B-lymphocyte subpopulations in human peripheral blood: a cost-effective seven-color one-tube protocol[J]. Methods Mol Biol, 2025, 2857: 15-31.
[24]	MOUAT I C, GOLDBERG E, HORWITZ M S. Age-associated B cells in autoimmune diseases[J]. Cell Mol Life Sci, 2022, 79(8): 402.
[25]	DU W H, HAN M, ZHU X X, et al. The multiple roles of B cells in the pathogenesis of sjögren's syndrome[J]. Front Immunol, 2021, 12: 684999.
[26]	XING Y X, LI B Y, WEI P, et al. Profiles of peripheral B cell subsets in a cohort of primary Sjögren's syndrome patients and their potential clinical significance[J]. J Dent Sci, 2024, 19(3): 1554-1563.
[27]	YIN Y Y, YANG X Y, WU S S, et al. Jmjd1c demethylates STAT3 to restrain plasma cell differentiation and rheumatoid arthritis[J]. Nat Immunol, 2022, 23(9): 1342-1354.
[28]	GU J S, XU Y S, HUA D H, et al. Role of artesunate in autoimmune diseases and signaling pathways[J]. Immunotherapy, 2023, 15(14): 1183-1193.