Mechanistic study of OGT-promoted non-small cell lung cancer proliferation via the ERK signaling pathway

doi:10.3969/j.issn.1674-8115.2025.10.004

Abstract

Abstract:

Objective ·To investigate the expression level of O-GlcNAc transferase (OGT) in non-small cell lung cancer (NSCLC) and its impact on lung cancer proliferation, as well as to explore the underlying mechanisms. Methods ·The expression of OGT in NSCLC tumors and adjacent normal tissues was detected by immunohistochemistry (IHC). The dataset (GSE31210) from the GEO database was analyzed to assess the correlation between OGT expression and NSCLC patient prognosis. siRNA transfection was performed to knock down OGT expression in H460 and H1299 cells, followed by total RNA extraction and transcriptome sequencing. Pathway enrichment analysis was conducted on differentially downregulated genes in the knockdown group compared with the control group, and Western blotting was used to validate the enrichment results. The effects of OGT knockdown on cell proliferation and colony formation in H460 and H1299 cells were evaluated using the cell counting kit-8 (CCK-8) assay and colony formation assay, respectively. The impact of overexpressing downstream genes was also examined. Stable OGT-knockdown cell lines were generated using shRNA and subcutaneously inoculated into nude mice to monitor tumor growth. Results ·IHC revealed that OGT expression was significantly upregulated in NSCLC tumor tissues compared to adjacent normal tissues. Patients with high OGT expression exhibited shorter survival times and poorer prognoses than those with low expression. Transcriptome sequencing demonstrated that genes downregulated after OGT knockdown were primarily enriched in the mitogen-activated protein kinase (MAPK) signaling pathway. Western blotting showed that total extracellular regulated protein kinase 1/2 (ERK1/2) levels remained unchanged in H460 and H1299 cells after OGT knockdown, while phosphorylated ERK1/2 (p-ERK1/2) and its downstream proto-oncogene JUNB protein were markedly reduced. Suppression of OGT expression attenuated the proliferation rate and colony formation capacity of H460 and H1299 cells, whereas JUNB overexpression rescued the proliferation defects induced by OGT knockdown. Notably, H460 cells with stable OGT knockdown formed significantly smaller tumors in nude mice. Conclusion ·OGT is highly expressed in NSCLC and correlates with poor prognosis. Knockdown of OGT inhibits NSCLC cell proliferation and clonogenicity in vitro, and tumor growth in vivo. Mechanistically, OGT appears to promote NSCLC progression by activating the ERK/JUNB signaling axis.

Key words: non-small cell lung cancer (NSCLC), O-GlcNAc transferase (OGT), extracellular regulated protein kinase (ERK), cell proliferation

CLC Number:

R734.2

ZHANG Xianzhou, DU Fenglin, WU Lei, REN Yizhe, ZHAO Mingna, LOU Jiatao. Mechanistic study of OGT-promoted non-small cell lung cancer proliferation via the ERK signaling pathway[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(10): 1288-1297.

Figures/Tables 7

TrendMD

References 27

[1]	LEITER A, VELUSWAMY R R, WISNIVESKY J P. The global burden of lung cancer: current status and future trends[J]. Nat Rev Clin Oncol, 2023, 20(9): 624-639.
[2]	WU Y L, LU S, ZHOU Q H, et al. Expert consensus on treatment for stage Ⅲ non-small cell lung cancer[J]. Med Adv, 2023, 1(1): 3-13.
[3]	LAHIRI A, MAJI A, POTDAR P D, et al. Lung cancer immunotherapy: progress, pitfalls, and promises[J]. Mol Cancer, 2023, 22(1): 40.
[4]	HE M Y, ZHOU X X, WANG X. Glycosylation: mechanisms, biological functions and clinical implications[J]. Signal Transduct Target Ther, 2024, 9(1): 194.
[5]	LE MINH G, ESQUEA E M, YOUNG R G, et al. On a sugar high: role of O-GlcNAcylation in cancer[J]. J Biol Chem, 2023, 299(11): 105344.
[6]	LIU X, WANG J, XIANG Y X, et al. The roles of OGT and its mechanisms in cancer[J]. Cell Biosci, 2024, 14(1): 121.
[7]	GE X, PENG X, LI M M, et al. OGT regulated O-GlcNacylation promotes migration and invasion by activating IL-6/STAT3 signaling in NSCLC cells[J]. Pathol Res Pract, 2021, 225: 153580.
[8]	VÁSQUEZ MARTÍNEZ I P, PÉREZ-CAMPOS E, PÉREZ-CAMPOS MAYORAL L, et al. O-GlcNAcylation: crosstalk between hemostasis, inflammation, and cancer[J]. Int J Mol Sci, 2024, 25(18): 9896.
[9]	MA Y L, HUANG X C, WANG Y Z, et al. NNMT/1-MNA promote cell-cycle progression of breast cancer by targeting UBC12/cullin-1-mediated degradation of P27 proteins[J]. Adv Sci (Weinh), 2024, 11(9): e2305907.
[10]	WANG H J, SUN J, SUN H F, et al. The OGT-c-Myc-PDK2 axis rewires the TCA cycle and promotes colorectal tumor growth[J]. Cell Death Differ, 2024, 31(9): 1157-1169.
[11]	ZHU Q, WANG H X, CHAI S Y, et al. O-GlcNAcylation promotes tumor immune evasion by inhibiting PD-L1 lysosomal degradation[J]. Proc Natl Acad Sci USA, 2023, 120(13): e2216796120.
[12]	LAVOIE H, GAGNON J, THERRIEN M. ERK signalling: a master regulator of cell behaviour, life and fate[J]. Nat Rev Mol Cell Biol, 2020, 21(10): 607-632.
[13]	SONG Y L, BI Z F, LIU Y, et al. Targeting RAS-RAF-MEK-ERK signaling pathway in human cancer: current status in clinical trials[J]. Genes Dis, 2022, 10(1): 76-88.
[14]	GUO Y J, PAN W W, LIU S B, et al. ERK/MAPK signalling pathway and tumorigenesis[J]. Exp Ther Med, 2020, 19(3): 1997-2007.
[15]	HUANG Y, ZHANG H L, LI Z L, et al. FUT8-mediated aberrant N-glycosylation of B7H3 suppresses the immune response in triple-negative breast cancer[J]. Nat Commun, 2021, 12(1): 2672.
[16]	LENZA M P, EGIA-MENDIKUTE L, ANTOÑANA-VILDOSOLA A, et al. Structural insights into siglec-15 reveal glycosylation dependency for its interaction with T cells through integrin CD11b[J]. Nat Commun, 2023, 14(1): 3496.
[17]	PANDEY A, NIKNEJAD N, JAFAR-NEJAD H. Multifaceted regulation of notch signaling by glycosylation[J]. Glycobiology, 2021, 31(1): 8-28.
[18]	DI GREGORIO J, DI GIUSEPPE L, TERRERI S, et al. Protein stability regulation in osteosarcoma: the ubiquitin-like modifications and glycosylation as mediators of tumor growth and as targets for therapy[J]. Cells, 2024, 13(6): 537.
[19]	RAN Z H, ZHANG L, DONG M, et al. O-GlcNAcylation: a crucial regulator in cancer-associated biological events[J]. Cell Biochem Biophys, 2023, 81(3): 383-394.
[20]	XU Y Y, SHENG X Y, ZHAO T, et al. O-GlcNAcylation of MEK2 promotes the proliferation and migration of breast cancer cells[J]. Glycobiology, 2021, 31(5): 571-581.
[21]	ZHANG Y H, SUN C N, MA L N, et al. O-GlcNAcylation promotes malignancy and cisplatin resistance of lung cancer by stabilising NRF2[J]. Clin Transl Med, 2024, 14(10): e70037.
[22]	SMITH B A H, BERTOZZI C R. The clinical impact of glycobiology: targeting selectins, siglecs and mammalian glycans[J]. Nat Rev Drug Discov, 2021, 20(3): 217-243.
[23]	SCHJOLDAGER K T, NARIMATSU Y, JOSHI H J, et al. Global view of human protein glycosylation pathways and functions[J]. Nat Rev Mol Cell Biol, 2020, 21(12): 729-749.
[24]	STEPHEN H M, ADAMS T M, WELLS L. Regulating the regulators: mechanisms of substrate selection of the O-GlcNAc cycling enzymes OGT and OGA[J]. Glycobiology, 2021, 31(7): 724-733.
[25]	FU L L, CHEN S W, HE G, et al. Targeting extracellular signal-regulated protein kinase 1/2 (ERK1/2) in cancer: an update on pharmacological small-molecule inhibitors[J]. J Med Chem, 2022, 65(20): 13561-13573.
[26]	ZHONG L, LI Y S, XIONG L, et al. Small molecules in targeted cancer therapy: advances, challenges, and future perspectives[J]. Signal Transduct Target Ther, 2021, 6(1): 201.
[27]	LI J, ZHOU W, ZHANG J Z, et al. O-GlcNAcylation of YTHDF2 antagonizes ERK-dependent phosphorylation and inhibits lung carcinoma[J/OL]. Fundam Res, 2025, 5(5): 2388-2396.

siRNA	Forward	Reverse
si-OGT	GUGCAACAGUAUACGUUAATT	UUAACGUAUACUGUUGCACTT
si-Ctrl	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT

siRNA	Forward	Reverse
si-OGT	GUGCAACAGUAUACGUUAATT	UUAACGUAUACUGUUGCACTT
si-Ctrl	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT

Gene	Forward	Reverse
OGT	TCCTGATTTGTACTGTGTTCGC	AAGCTACTGCAAAGTTCGGTT
β-actin	ATCAAGATCATTGCTCCTCCTGAG	CTGCTTGCTGATCCACATCTG

Gene	Forward	Reverse
OGT	TCCTGATTTGTACTGTGTTCGC	AAGCTACTGCAAAGTTCGGTT
β-actin	ATCAAGATCATTGCTCCTCCTGAG	CTGCTTGCTGATCCACATCTG

Primer	Forward	Reverse
sh-OGT-1	GATCCGCTTGCAATTCATCACTTTGACTCGAGTCAAAGTGATGAATTGCAAGCTTTTTG	AATTCAAAAAGCTTGCAATTCATCACTTTGACTCGAGTCAAAGTGATGAATTGCAAGCG
sh-OGT-2	GATCCGCTGCTGCCCATTCAAATTTACTCGAGTAAATTTGAATGGGCAGCAGCTTTTTG	AATTCAAAAAGCTGCTGCCCATTCAAATTTACTCGAGTTAAATTTGAATGGGCAGCAGCG
sh-Ctrl	GATCCCCCTTCTGACATCTCCTACATCTCGAGATGTAGGAGATGTCAGAAGGGTTTTTG	AATTCAAAAACCCTTCTGACATCTCCTACATCTCGAGATGTAGGAGATGTCAGAAGGGG