Selenoprotein SELENOI promotes the proliferation, migration and invasion of gastric cancer through the PI3K/AKT/mTOR signaling pathway

doi:10.3969/j.issn.1674-8115.2026.08.003

Abstract

Abstract:

Objective ·To investigate the regulatory role of the selenoprotein SELENOI (ethanolamine phosphotransferase 1, EPT1) in the proliferation, migration and invasion of gastric cancer cells, as well as its molecular mechanism. Methods ·The expression levels of SELENOI in gastric mucosal epithelial cells and gastric cancer cell lines were detected using Western blotting and quantitative real-time PCR (qPCR). The clinical pathological data of 100 patients who underwent surgery at the Department of Gastrointestinal Surgery of Renji Hospital, Shanghai Jiao Tong University School of Medicine, from 2010 to 2015 were collected, and the association between SELENOI expression levels and patient prognosis was analyzed. The expression of SELENOI in gastric adenocarcinoma tumor tissues and normal tissues was analyzed based on The Cancer Genome Atlas (TCGA) database. The differentially expressed genes between the SELENOI high- and low-expression groups were screened, and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis was performed to select SELENOI-related signaling pathways. The regulatory association of SELENOI with this pathway was verified by qPCR and Western blotting. HGC-27 and NUGC-3 gastric cancer cells were treated with SELENOI-targeted small interfering RNA (siRNA), SELENOI overexpression plasmid alone, or in combination with the mechanistic target of rapamycin (mTOR) inhibitor rapamycin. The cell proliferation ability was detected by CCK-8 assay, and cell migration and invasion abilities were detected by Transwell assay. Results ·Bioinformatics analysis revealed that SELENOI was significantly highly expressed in gastric cancer tissues (P<0.05). Kaplan-Meier survival analysis of 100 patients with gastric adenocarcinoma showed that patients with high SELENOI expression had worse prognosis (P=0.022). qPCR and Western blotting results confirmed that the expression levels of SELENOI in HGC-27, NUGC-3, AGS, and MKN45 gastric cancer cell lines were significantly higher than those in gastric mucosal epithelial cells GES-1 (all P<0.05). KEGG pathway enrichment analysis and subsequent molecular validation experiments confirmed that SELENOI promoted the activation of the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT)/mTOR signaling pathway in gastric cancer. CCK-8 and Transwell assay results showed that SELENOI enhanced the proliferation, migration and invasion abilities of gastric cancer cells by activating the PI3K/AKT/mTOR signaling pathway, and rapamycin significantly reversed this tumor-promoting effect. Conclusion ·SELENOI is highly expressed in gastric cancer tissues and cells. SELENOI can promote the proliferation, migration and invasion of gastric cancer cells by activating the PI3K/AKT/mTOR signaling pathway.

Key words: SELENOI, phosphatidylinositol 3-kinase (PI3K), protein kinase B (AKT), mechanistic target of rapamycin (mTOR), gastric cancer

CLC Number:

R735.2

Wang Mingjie, Ni Bo, Xia Xiang, Zhang Zizhen. Selenoprotein SELENOI promotes the proliferation, migration and invasion of gastric cancer through the PI3K/AKT/mTOR signaling pathway[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026,(8): 1015-1025.

Figures/Tables 9

TrendMD

References 23

[1]	吴琪, 范伯男, 李岩. 2022全球癌症统计报告分析解读: 中国与世界癌症疾病负担与流行趋势[J]. 诊断学理论与实践, 2025, 24(2): 135-145.
	Wu Q, Fan B N, Li Y. Analysis and interpretation of the 2022 Global Cancer Statistics Report: cancer burden and epidemiological trends in China and the world[J]. Journal of Diagnostics: Concepts & Practice, 2025, 24(2): 135-145.
[2]	Zheng R S, Zhang S W, Zeng H M, et al. Cancer incidence and mortality in China, 2016[J]. J Natl Cancer Cent, 2022, 2(1): 1-9.
[3]	Han B F, Zheng R S, Zeng H M, et al. Cancer incidence and mortality in China, 2022[J]. J Natl Cancer Cent, 2024, 4(1): 47-53.
[4]	Henneberry A L, Lagace T A, Ridgway N D, et al. Phosphatidylcholine synthesis influences the diacylglycerol homeostasis required for SEC14p-dependent Golgi function and cell growth[J]. Mol Biol Cell, 2001, 12(3): 511-520.
[5]	Nunes L G A, Ma C, Pitts M W, et al. Insights from selenoprotein I mouse models for understanding biological roles of this enzyme[J]. Arch Biochem Biophys, 2025, 768: 110394.
[6]	Horibata Y, Maeda S, Konishi A. A Gly-to-Ala substitution confers choline phosphotransferase activity on the CDP-ethanolamine-specific mammalian EPT1[J]. Genes Cells, 2026, 31(2): e70095.
[7]	Ma C, Hoffmann F W, Shay A E, et al. Upregulated selenoprotein I during lipopolysaccharide-induced B cell activation promotes lipidomic changes and is required for effective differentiation into IgM-secreting plasma B cells[J]. J Leukoc Biol, 2024, 116(1): 6-17.
[8]	Ma C, Hoffmann F W, Marciel M P, et al. Upregulated ethanolamine phospholipid synthesis via selenoprotein I is required for effective metabolic reprogramming during T cell activation[J]. Mol Metab, 2021, 47: 101170.
[9]	Ma C, Martinez-Rodriguez V, Hoffmann P R. Roles for selenoprotein I and ethanolamine phospholipid synthesis in T cell activation[J]. Int J Mol Sci, 2021, 22(20): 11174.
[10]	Ma C, Hoffmann F W, Nunes L G, et al. Selenoprotein I deficiency in T cells promotes differentiation into tolerant phenotypes while decreasing Th17 pathology[J]. J Leukoc Biol, 2022, 112(6): 1387-1397.
[11]	Shi Z, Han Z Y, Chen J Y, et al. Endoplasmic reticulum-resident selenoproteins and their roles in glucose and lipid metabolic disorders[J]. Biochim Biophys Acta Mol Basis Dis, 2024, 1870(6): 167246.
[12]	Zhang X, Xiong W, Gao F, et al. Impacts and mechanism of liver-specific knockout of selenoprotein I on hepatic phospholipid metabolism, selenogenome expression, redox status, and resistance to CCl₄ toxicity[J]. Free Radic Biol Med, 2025, 235: 426-442.
[13]	Huang X, Li T, Yang S H, et al. Hepatocyte-specific SELENOI deficiency predisposes mice to hepatic steatosis and obesity[J]. FASEB J, 2024, 38(11): e23717.
[14]	Nunes L G A, Pitts M W, Hoffmann P R. Selenoprotein I (SELENOI) as a critical enzyme in the central nervous system[J]. Arch Biochem Biophys, 2022, 729: 109376.
[15]	Nunes L G A, Ma C, Hoffmann F W, et al. Selenoprotein I is indispensable for ether lipid homeostasis and proper myelination[J]. J Biol Chem, 2024, 300(5): 107259.
[16]	Huang X, Yang X, Zhang M X, et al. SELENOI functions as a key modulator of ferroptosis pathway in colitis and colorectal cancer[J]. Adv Sci (Weinh), 2024, 11(28): e2404073.
[17]	Li J, Chen M M, Huang D W, et al. Inhibition of selenoprotein I promotes ferroptosis and reverses resistance to platinum chemotherapy by impairing Akt phosphorylation in ovarian cancer[J]. MedComm, 2024, 5(12): e70033.
[18]	Cao Y J, Luo Y C, Zou J, et al. Autophagy and its role in gastric cancer[J]. Clin Chim Acta, 2019, 489: 10-20.
[19]	Wong H, Yau T. Targeted therapy in the management of advanced gastric cancer: are we making progress in the era of personalized medicine?[J]. Oncologist, 2012, 17(3): 346-358.
[20]	Byun D S, Cho K, Ryu B K, et al. Frequent monoallelic deletion of PTEN and its reciprocal association with PIK3CA amplification in gastric carcinoma[J]. Int J Cancer, 2003, 104(3): 318-327.
[21]	Baghery Saghchy Khorasani A, Pourbagheri-Sigaroodi A, Pirsalehi A, et al. The PI3K/Akt/mTOR signaling pathway in gastric cancer; from oncogenic variations to the possibilities for pharmacologic interventions[J]. Eur J Pharmacol, 2021, 898: 173983.
[22]	Wadhwa R, Song S M, Lee J S, et al. Gastric cancer-molecular and clinical dimensions[J]. Nat Rev Clin Oncol, 2013, 10(11): 643-655.
[23]	Sukawa Y, Yamamoto H, Nosho K, et al. HER2 expression and PI3K-Akt pathway alterations in gastric cancer[J]. Digestion, 2014, 89(1): 12-17.

Name	Forward (5'→3')	Reverse (5'→3')
siRNA-NC	UUCUCCGAACGAGUCACGUTT	ACGUGACUCGUUCGGAGAATT
siRNA-SELENOI-1	CCUAGAGUAUUCUACUUUATT	UAAAGUAGAAUACUCUAGGTT
siRNA-SELENOI-2	GAUUAUUGGUUGUGCAUUATT	UAAUGCACAACCAAUAAUCTT
siRNA-SELENOI-3	GGAUAGUUGGUCAUGUGUUTT	AACACAUGACCAACUAUCCTT

Name	Forward (5'→3')	Reverse (5'→3')
siRNA-NC	UUCUCCGAACGAGUCACGUTT	ACGUGACUCGUUCGGAGAATT
siRNA-SELENOI-1	CCUAGAGUAUUCUACUUUATT	UAAAGUAGAAUACUCUAGGTT
siRNA-SELENOI-2	GAUUAUUGGUUGUGCAUUATT	UAAUGCACAACCAAUAAUCTT
siRNA-SELENOI-3	GGAUAGUUGGUCAUGUGUUTT	AACACAUGACCAACUAUCCTT

Gene	Forward (5'→3')	Reverse (5'→3')
GAPDH	GAGAAGGCTGGGGCTCATTT	AGTGATGGCATGGACTGTGG
SELENOI	AAGCAAGCTCGCAGAACCAA	ATGTCATATCCCCATGGCAGG
PI3K	CTTTGGCCAGTACCTCATGGA	TGTTACTCAGTCCTGCGTGG
AKT	CTCTTTCCAGACCCACGACC	TAATGTGCCCGTCCTTGTCC
mTOR	GATGACTGGCTGGAATGGCT	GGTCTGTGTGACTTCAGCGA

Gene	Forward (5'→3')	Reverse (5'→3')
GAPDH	GAGAAGGCTGGGGCTCATTT	AGTGATGGCATGGACTGTGG
SELENOI	AAGCAAGCTCGCAGAACCAA	ATGTCATATCCCCATGGCAGG
PI3K	CTTTGGCCAGTACCTCATGGA	TGTTACTCAGTCCTGCGTGG
AKT	CTCTTTCCAGACCCACGACC	TAATGTGCCCGTCCTTGTCC
mTOR	GATGACTGGCTGGAATGGCT	GGTCTGTGTGACTTCAGCGA

Characteristic	SELENOI high-expression group (n=50)	SELENOI low-expression group (n=50)	t/Z/χ² value	P value
Age/year	64.80±10.97	62.62±12.34	0.934	0.386
Gender/n(%)			0.049	0.826
Male	35 (70.0)	36 (72.0)
Female	15 (30.0)	14 (28.0)
T stage/n(%)			0.798	0.425
T1	1 (2.0)	1 (2.0)
T2	1 (2.0)	3 (6.0)
T3	6 (12.0)	7 (14.0)
T4	42 (84.0)	39 (78.0)
N stage/n(%)			0.279	0.780
N0	10 (20.0)	12 (24.0)
N1	10 (20.0)	7 (14.0)
N2	12 (24.0)	15 (30.0)
N3	18 (36.0)	16 (32.0)
Clinical stage/n(%)			0.713	0.476
Ⅰ	0 (0)	1 (2.0)
Ⅱ	13 (26.0)	15 (30.0)
Ⅲ	37 (74.0)	34 (68.0)
Ⅳ	0 (0)	0 (0)