
Journal of Shanghai Jiao Tong University (Medical Science) ›› 2023, Vol. 43 ›› Issue (8): 1008-1016.doi: 10.3969/j.issn.1674-8115.2023.08.008
• Basic research • Previous Articles Next Articles
SONG Wenting1(
), TAO Yue2, PAN Yi2, MO Xi2, CAO Qing1(
)
Received:2023-04-18
Accepted:2023-05-06
Online:2023-08-28
Published:2023-08-28
Contact:
CAO Qing
E-mail:tsuyo300@163.com;caoqing@scmc.com.cn
CLC Number:
SONG Wenting, TAO Yue, PAN Yi, MO Xi, CAO Qing. SIRT2 regulates macrophage chemotaxis by de-modifying histone H4K8 lactylation[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023,(8): 1008-1016.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2023.08.008
| Gene | Forward primer (5´→3´) | Reverse primer (5´→3´) |
|---|---|---|
| HIF-1α | GAACGTCGAAAAGAAAAGTCTCG | CCTTATCAAGATGCGAACTCACA |
| PFKL | GTACCTGGCGCTGGTATCTG | CCTCTCACACATGAAGTTCTCC |
| LDHA | ATGGCAACTCTAAAFFATCAGC | CCAACCCCAACAACTGTAATCT |
| SIRT1 | AGGCCACGGATAGGTCCATA | GTGGAGGTATTGTTTCCGGC |
| SIRT2 | TGCGGAACTTATTCTCCCAGA | GAGAGCGAAAGTCGGGGAT |
| SIRT3 | TGCTCATCAACCGGGACTTG | TTGTCTGGTCCATCAAGCCTA |
| SIRT5 | CTCAAGATGCCAGCATCCCA | AGGAAGTGCCCACCACTAGA |
| HDAC1 | CATCGCTGTGAATTGGGCTG | ACCCTCTGGTGATACTTTAGCAG |
| HDAC2 | TCTGCTACTACTACGACGGTGA | TCATTTCTTCGGCAGTGGCT |
| HDAC3 | CATGACGGTGTCCTTCCACA | CAGAGTCAGCTCCACACTGG |
| GAPDH | TCTCCTCTGACTTCAACAGCGACA | CCCTGTTGCTGTAGCCAAATTCGT |
Tab 1 Primer sequences for real-time qPCR
| Gene | Forward primer (5´→3´) | Reverse primer (5´→3´) |
|---|---|---|
| HIF-1α | GAACGTCGAAAAGAAAAGTCTCG | CCTTATCAAGATGCGAACTCACA |
| PFKL | GTACCTGGCGCTGGTATCTG | CCTCTCACACATGAAGTTCTCC |
| LDHA | ATGGCAACTCTAAAFFATCAGC | CCAACCCCAACAACTGTAATCT |
| SIRT1 | AGGCCACGGATAGGTCCATA | GTGGAGGTATTGTTTCCGGC |
| SIRT2 | TGCGGAACTTATTCTCCCAGA | GAGAGCGAAAGTCGGGGAT |
| SIRT3 | TGCTCATCAACCGGGACTTG | TTGTCTGGTCCATCAAGCCTA |
| SIRT5 | CTCAAGATGCCAGCATCCCA | AGGAAGTGCCCACCACTAGA |
| HDAC1 | CATCGCTGTGAATTGGGCTG | ACCCTCTGGTGATACTTTAGCAG |
| HDAC2 | TCTGCTACTACTACGACGGTGA | TCATTTCTTCGGCAGTGGCT |
| HDAC3 | CATGACGGTGTCCTTCCACA | CAGAGTCAGCTCCACACTGG |
| GAPDH | TCTCCTCTGACTTCAACAGCGACA | CCCTGTTGCTGTAGCCAAATTCGT |
| 1 | GALLI G, SALEH M. Immunometabolism of macrophages in bacterial infections[J]. Front Cell Infect Microbiol, 2021, 10: 607650. |
| 2 | VIOLA A, MUNARI F, SÁNCHEZ-RODRÍGUEZ R, et al. The metabolic signature of macrophage responses[J]. Front Immunol, 2019, 10: 1462. |
| 3 | PETER K, REHLI M, SINGER K, et al. Lactic acid delays the inflammatory response of human monocytes[J]. Biochem Biophys Res Commun, 2015, 457(3): 412-418. |
| 4 | ERREA A, CAYET D, MARCHETTI P, et al. Lactate inhibits the pro-inflammatory response and metabolic reprogramming in murine macrophages in a GPR81-independent manner[J]. PLoS One, 2016, 11(11): e0163694. |
| 5 | NAREIKA A, HE L, GAME B A, et al. Sodium lactate increases LPS-stimulated MMP and cytokine expression in U937 histiocytes by enhancing AP-1 and NF-κB transcriptional activities[J]. Am J Physiol Endocrinol Metab, 2005, 289(4): E534-E542. |
| 6 | SAMUVEL D J, SUNDARARAJ K P, NAREIKA A, et al. Lactate boosts TLR4 signaling and NF-κB pathway-mediated gene transcription in macrophages via monocarboxylate transporters and MD-2 up-regulation[J]. J Immunol, 2009, 182(4): 2476-2484. |
| 7 | XU H W, WU M Y, MA X M, et al. Function and mechanism of novel histone posttranslational modifications in health and disease[J]. Biomed Res Int, 2021, 2021: 6635225. |
| 8 | MOHAMMADI A, SHARIFI A, POURPAKNIA R, et al. Manipulating macrophage polarization and function using classical HDAC inhibitors: implications for autoimmunity and inflammation[J]. Crit Rev Oncol, 2018, 128: 1-18. |
| 9 | ZHANG D, TANG Z Y, HUANG H, et al. Metabolic regulation of gene expression by histone lactylation[J]. Nature, 2019, 574(7779): 575-580. |
| 10 | MURRAY P J, WYNN T A. Protective and pathogenic functions of macrophage subsets[J]. Nat Rev Immunol, 2011, 11(11): 723-737. |
| 11 | NEWSHOLME P, GORDON S, NEWSHOLME E A. Rates of utilization and fates of glucose, glutamine, pyruvate, fatty acids and ketone bodies by mouse macrophages[J]. Biochem J, 1987, 242(3): 631-636. |
| 12 | PARK D, LIM G, YOON S J, et al. The role of immunomodulatory metabolites in shaping the inflammatory response of macrophages[J]. BMB Rep, 2022, 55(11): 519-527. |
| 13 | COLEGIO O R, CHU N Q, SZABO A L, et al. Functional polarization of tumour-associated macrophages by tumour-derived lactic acid[J]. Nature, 2014, 513(7519): 559-563. |
| 14 | DIETL K, RENNER K, DETTMER K, et al. Lactic acid and acidification inhibit TNF secretion and glycolysis of human monocytes[J]. J Immunol, 2010, 184(3): 1200-1209. |
| 15 | AWASTHI D, NAGARKOTI S, SADAF S, et al. Glycolysis dependent lactate formation in neutrophils: a metabolic link between NOX-dependent and independent NETosis[J]. Biochim Biophys Acta Mol Basis Dis, 2019, 1865(12): 165542. |
| 16 | ALARCÓN P, MANOSALVA C, CONEJEROS I, et al. D (-) lactic acid-induced adhesion of bovine neutrophils onto endothelial cells is dependent on neutrophils extracellular traps formation and CD11b expression[J]. Front Immunol, 2017, 8: 975. |
| 17 | WU D, SHI Y X, ZHANG H, et al. Epigenetic mechanisms of Immune remodeling in sepsis: targeting histone modification[J]. Cell Death Dis, 2023, 14(2): 112. |
| 18 | CHEN L H, HUANG L X, GU Y, et al. Lactate-lactylation hands between metabolic reprogramming and immunosuppression[J]. Int J Mol Sci, 2022, 23(19): 11943. |
| 19 | IRIZARRY-CARO R A, MCDANIEL M M, OVERCAST G R, et al. TLR signaling adapter BCAP regulates inflammatory to reparatory macrophage transition by promoting histone lactylation[J]. Proc Natl Acad Sci USA, 2020, 117(48): 30628-30638. |
| 20 | KOVACS L, CAO Y P, HAN W H, et al. PFKFB3 in smooth muscle promotes vascular remodeling in pulmonary arterial hypertension[J]. Am J Respir Crit Care Med, 2019, 200(5): 617-627. |
| 21 | WANG N X, WANG W W, WANG X Q, et al. Histone lactylation boosts reparative gene activation post-myocardial infarction[J]. Circ Res, 2022, 131(11): 893-908. |
| 22 | MA W, AO S, ZHOU J, et al. Methylsulfonylmethane protects against lethal dose MRSA-induced sepsis through promoting M2 macrophage polarization[J]. Mol Immunol, 2022, 146: 69-77. |
| 23 | CHU X, DI C Y, CHANG P P, et al. Lactylated histone H3K18 as a potential biomarker for the diagnosis and predicting the severity of septic shock[J]. Front Immunol, 2022, 12: 786666. |
| 24 | MORENO-YRUELA C, ZHANG D, WEI W, et al. Class Ⅰ histone deacetylases (HDAC1-3) are histone lysine delactylases[J]. Sci Adv, 2022, 8(3): eabi6696. |
| 25 | DAI H, SINCLAIR D A, ELLIS J L, et al. Sirtuin activators and inhibitors: promises, achievements, and challenges[J]. Pharmacol Ther, 2018, 188: 140-154. |
| 26 | WANG Y, YANG J, HONG T, et al. SIRT2: controversy and multiple roles in disease and physiology[J]. Ageing Res Rev, 2019, 55: 100961. |
| 27 | XU H, YU X, WANG B, et al. The clinical significance of the SIRT2 expression level in the early stage of sepsis patients[J]. Ann Palliat Med, 2020, 9(4): 1413-1419. |
| 28 | SASSO G L, MENZIES K J, MOTTIS A, et al. SIRT2 deficiency modulates macrophage polarization and susceptibility to experimental colitis[J]. PLoS One, 2014, 9(7): e103573. |
| 29 | ZU H X, LI C, DAI C R, et al. SIRT2 functions as a histone delactylase and inhibits the proliferation and migration of neuroblastoma cells[J]. Cell Discov, 2022, 8(1): 54. |
| 30 | TU Q Q, YU X Y, XIE W, et al. Prokineticin 2 promotes macrophages-mediated antibacterial host defense against bacterial pneumonia[J]. Int J Infect Dis, 2022, 125: 103-113. |
| [1] | Du Xin, Li Xuebing, Li Yongwei. Research progress of macrophage metabolic reprogramming in recurrent spontaneous abortion [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(4): 537-544. |
| [2] | Qian Yile, Yao Sai, Chen Sifeng, Li Quanfu, Zhao Meng. Research progress on the molecular mechanisms and targeted interventions of macrophage-mediated myocardial fibrosis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(3): 348-357. |
| [3] | Yin Wenyu, Wang Ruijie, Ma Hailong, Jin Shufang. Study on how histone lysine lactylation regulates zinc finger protein 668 to facilitate proliferation of head and neck squamous cell carcinoma cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(2): 151-162. |
| [4] | JIANG Qianyu, YAO Chengcheng, JI Ping, WANG Ying. Microenvironmental profiles of wound tissues with accelerated healing properties by HAMA hydrogel [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(8): 969-980. |
| [5] | WANG Lin, XU Ping, ZHANG Qiaoting, TIAN Jun, LOU Xiaoli, WANG Jing. Role of CARD9 in macrophage M1 polarization in severe acute pancreatitis rats [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(8): 981-989. |
| [6] | HAN Longchuan, LI Yue, ZOU Zhihui, LUO Jing, LI Ruoyi, ZHANG Yingting, TANG Xinxin, TIAN Lihong, LU Yuheng, HUANG Ying, HE Ming, FU Yinkun. Phosphatidylethanolamine promotes macrophage senescence and liver injury by activating endoplasmic reticulum stress [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(6): 693-704. |
| [7] | HUANG Yinghe, ZHAO Guanyu, SUN Yang, HOU Jianji, ZUO Yong. Research progress on macrophage metabolic regulation in wound healing of diabetes mellitus type 2 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(6): 792-799. |
| [8] | TANG Kairan, FENG Chengling, HAN Bangmin. Integrated single-cell and transcriptome sequencing to construct a prognostic model of M2 macrophage-related genes in prostate cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(5): 549-561. |
| [9] | NI Shuyi, JIANG Zhao, WANG Zhongtao, HE Shumei. Effect of salidroside on the immune function of BCG-infected macrophages [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(4): 426-433. |
| [10] | MA Xiuzhen, ZHOU Ni, GUO Siqi, WANG Yuanyuan, MAI Ping. Cannabinoid receptor 1 promotes M1 polarization of macrophages through the Gαi/o/RhoA signaling pathway in mice with acute lung injury [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(2): 161-168. |
| [11] | XIAO Shuyu, TULAMATI Aziguli, YANG Yan, ZHANG Zhigang, YANG Xiaomei, DU Chang, ZHANG Xueli. Synthesis of the serotonin derivative 5-PT and establishment of a research system for protein serotonylation [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(2): 211-221. |
| [12] | ZHANG Yesheng, YANG Yijing, HUANG Yiwen, SHI Longyu, WANG Manyuan, CHEN Sisi. Research progress in immune cells regulating drug resistance of tumor cells in tumor microenvironment [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(7): 830-838. |
| [13] | NIU Yuanyuan, WANG Longde, XU Wenjuan, LI Zhengju, ZHANG Ruiting, WU Yuqian. Research progress in the role of M1/M2 polarization of macrophages in different liver diseases [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 509-517. |
| [14] | ZHANG Yutong, HOU Guojun, SHEN Nan. Comparison of human-induced pluripotent stem cell-derived macrophages with peripheral blood-derived macrophages using single-cell genomics [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(12): 1477-1489. |
| [15] | WU Qiqi, WANG Hao, LIN Li, YAN Bo, ZHANG Shulin. miR-185-5p facilitates intracellular Mycobacterium growth via inhibiting macrophage autophagy [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 699-708. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||