
Journal of Shanghai Jiao Tong University (Medical Science) ›› 2024, Vol. 44 ›› Issue (2): 145-160.doi: 10.3969/j.issn.1674-8115.2024.02.001
• Basic research • Next Articles
DENG Qingsong1,2,3(
), ZHANG Changqing1,2,3, TAO Shicong1,2(
)
Received:2023-08-07
Accepted:2023-11-30
Online:2024-02-28
Published:2024-02-28
Contact:
TAO Shicong
E-mail:dqs1229@163.com;sctao@shsmu.edu.cn
Supported by:CLC Number:
DENG Qingsong, ZHANG Changqing, TAO Shicong. Exploration of the relationship between nicotinamide metabolism-related genes and osteoarthritis[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024,(2): 145-160.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2024.02.001
| siRNA | Sense (5'→3') | Antisense (5'→3') |
|---|---|---|
| siNPAS2 | CAAAGGAAUUUCCAACUUAUGTT | CAUAAGUUGGAAAUUCCUUUGTT |
| siNAMPT | GCAGGACUUGCUCUAAUUAAATT | UUUAAUUAGAGCAAGUCCUGCTT |
| siTIPARP | CCAAGAGAACGGAAUUGAAAUTT | AUUUCAAUUCCGUUCUCUUGGTT |
Tab 1 Sequences for siRNA
| siRNA | Sense (5'→3') | Antisense (5'→3') |
|---|---|---|
| siNPAS2 | CAAAGGAAUUUCCAACUUAUGTT | CAUAAGUUGGAAAUUCCUUUGTT |
| siNAMPT | GCAGGACUUGCUCUAAUUAAATT | UUUAAUUAGAGCAAGUCCUGCTT |
| siTIPARP | CCAAGAGAACGGAAUUGAAAUTT | AUUUCAAUUCCGUUCUCUUGGTT |
| Primer | Forward primer (5'→3') | Reverse primer (5'→3') |
|---|---|---|
| β-actin | CCTCTATGCCAACACAGT | AGCCACCAATCCACACAG |
| ACAN | TGGAGACAAGGATGAGTTTCC | GGCGAAGCAGTACACATCATA |
| SOX9 | AACACCTTGAGCCTTAAAACG | GATTTCATCTCCTTTGCTTGC |
Tab 2 Primer sequences for RT-qPCR
| Primer | Forward primer (5'→3') | Reverse primer (5'→3') |
|---|---|---|
| β-actin | CCTCTATGCCAACACAGT | AGCCACCAATCCACACAG |
| ACAN | TGGAGACAAGGATGAGTTTCC | GGCGAAGCAGTACACATCATA |
| SOX9 | AACACCTTGAGCCTTAAAACG | GATTTCATCTCCTTTGCTTGC |
| 1 | HUNTER D J, BIERMA-ZEINSTRA S. Osteoarthritis[J]. Lancet, 2019, 393(10182): 1745-1759. |
| 2 | YAO Q, WU X H, TAO C, et al. Osteoarthritis: pathogenic signaling pathways and therapeutic targets[J]. Signal Transduct Target Ther, 2023, 8(1): 56. |
| 3 | REVOLLO J R, GRIMM A A, IMAI S. The NAD biosynthesis pathway mediated by nicotinamide phosphoribosyltransferase regulates Sir2 activity in mammalian cells[J]. J Biol Chem, 2004, 279(49): 50754-50763. |
| 4 | TRAVELLI C, COLOMBO G, MOLA S, et al. NAMPT: A pleiotropic modulator of monocytes and macrophages[J]. Pharmacol Res, 2018, 135: 25-36. |
| 5 | GARTEN A, SCHUSTER S, PENKE M, et al. Physiological and pathophysiological roles of NAMPT and NAD metabolism[J]. Nat Rev Endocrinol, 2015, 11(9): 535-546. |
| 6 | JOHNSON S, IMAI S. NAD+ biosynthesis, aging, and disease[J]. F1000Res, 2018, 7: 132. |
| 7 | YANG S, RYU J H, OH H, et al. NAMPT (visfatin), a direct target of hypoxia-inducible factor-2α, is an essential catabolic regulator of osteoarthritis[J]. Ann Rheum Dis, 2015, 74(3): 595-602. |
| 8 | PRESLE N, POTTIE P, DUMOND H, et al. Differential distribution of adipokines between serum and synovial fluid in patients with osteoarthritis. Contribution of joint tissues to their articular production[J]. Osteoarthritis Cartilage, 2006, 14(7): 690-695. |
| 9 | DAVIS S, MELTZER P S. GEOquery: a bridge between the Gene Expression Omnibus (GEO) and BioConductor[J]. Bioinformatics, 2007, 23(14):1846-1847. |
| 10 | HUBER R, HUMMERT C, GAUSMANN U, et al. Identification of intra-group, inter-individual, and gene-specific variances in mRNA expression profiles in the rheumatoid arthritis synovial membrane[J]. Arthritis Res Ther, 2008, 10(4): R98. |
| 11 | WOETZEL D, HUBER R, KUPFER P, et al. Identification of rheumatoid arthritis and osteoarthritis patients by transcriptome-based rule set generation[J]. Arthritis Res Ther, 2014, 16(2): R84. |
| 12 | STELZER G, ROSEN N, PLASCHKES I, et al. The GeneCards suite: from gene data mining to disease genome sequence analyses[J]. Curr Protoc Bioinformatics, 2016, 54: 1.30.1-1.30.33. |
| 13 | LIBERZON A, BIRGER C, THORVALDSDÓTTIR H, et al. The Molecular Signatures Database (MSigDB) hallmark gene set collection[J]. Cell Syst, 2015, 1(6): 417-425. |
| 14 | LEEK J T, JOHNSON W E, PARKER H S, et al. The sva package for removing batch effects and other unwanted variation in high-throughput experiments[J]. Bioinformatics, 2012, 28(6): 882-883. |
| 15 | RITCHIE M E, PHIPSON B, WU D, et al. Limma powers differential expression analyses for RNA-sequencing and microarray studies[J]. Nucleic Acids Res, 2015, 43(7): e47. |
| 16 | YU G, WANG L G, HAN Y, et al. clusterProfiler: an R package for comparing biological themes among gene clusters[J]. OMICS, 2012, 16(5): 284-287. |
| 17 | LIBERZON A, SUBRAMANIAN A, PINCHBACK R, et al. Molecular signatures database (MSigDB) 3.0[J]. Bioinformatics, 2011, 27(12): 1739-1740. |
| 18 | YANG L, QU Q, HAO Z, et al. Powerful identification of large quantitative trait loci using genome-wide R/glmnet-based regression[J]. J Hered, 2022, 113(4): 472-478. |
| 19 | NARALA S, LI S Q, KLIMAS N K, et al. Application of least absolute shrinkage and selection operator logistic regression for the histopathological comparison of chondrodermatitis nodularis helicis and hyperplastic actinic keratosis[J]. J Cutan Pathol, 2021, 48(6): 739-744. |
| 20 | PARK S Y. Nomogram: an analogue tool to deliver digital knowledge[J]. J Thorac Cardiovasc Surg, 2018, 155(4): 1793. |
| 21 | SUN L, PANG Y, WANG X, et al. Ablation of gut microbiota alleviates obesity-induced hepatic steatosis and glucose intolerance by modulating bile acid metabolism in hamsters[J]. Acta Pharm Sin B, 2019, 9(4): 702-710. |
| 22 | XIAO B, LIU L, LI A, et al. Identification and verification of immune-related gene prognostic signature based on ssGSEA for osteosarcoma[J]. Front Oncol, 2020, 10: 607622. |
| 23 | FRESHOUR S L, KIWALA S, COTTO K C, et al. Integration of the Drug-Gene Interaction Database (DGIdb 4.0) with open crowdsource efforts[J]. Nucleic Acids Res, 2021, 49(D1): D1144-D1151. |
| 24 | LI J H, LIU S, ZHOU H, et al. starBase v2.0: decoding miRNA-ceRNA, miRNA-ncRNA and protein-RNA interaction networks from large-scale CLIP-Seq data[J]. Nucleic Acids Res, 2014, 42(D1): D92-D97. |
| 25 | ZHOU K R, LIU S, SUN W J, et al. ChIPBase v2.0: decoding transcriptional regulatory networks of non-coding RNAs and protein-coding genes from ChIP-seq data[J]. Nucleic Acids Res, 2017, 45(D1): D43-D50. |
| 26 | NAVAS L E, CARNERO A. NAD+ metabolism, stemness, the immune response, and cancer[J]. Signal Transduct Target Ther, 2021, 6(1): 2. |
| 27 | WANG Q H, LI Y, DOU D Y, et al. Nicotinamide mononucleotide-elicited NAMPT signaling activation aggravated adjuvant-induced arthritis in rats by affecting peripheral immune cells differentiation[J]. Int Immunopharmacol, 2021, 98: 107856. |
| 28 | NOWELL M, EVANS L, WILLIAMS A. PBEF/NAMPT/visfatin: a promising drug target for treating rheumatoid arthritis?[J]. Future Med Chem, 2012, 4(6): 751-769. |
| 29 | DIOUM E M, RUTTER J, TUCKERMAN J R, et al. NPAS2: a gas-responsive transcription factor[J]. Science, 2002, 298(5602): 2385-2387. |
| 30 | BECKER-KRAIL D D, PAREKH P K, KETCHESIN K D, et al. Circadian transcription factor NPAS2 and the NAD+-dependent deacetylase SIRT1 interact in the mouse nucleus accumbens and regulate reward[J]. Eur J Neurosci, 2022, 55(3): 675-693. |
| 31 | ZHANG L, CAO J, DONG L, et al. TiPARP forms nuclear condensates to degrade HIF-1α and suppress tumorigenesis[J]. Proc Natl Acad Sci USA, 2020, 117(24): 13447-13456. |
| 32 | SWAHN H, OLMER M, LOTZ M K. RNA-binding proteins that are highly expressed and enriched in healthy cartilage but suppressed in osteoarthritis[J]. Front Cell Dev Biol, 2023, 11: 1208315. |
| 33 | WYATT L A, NWOSU L N, WILSON D, et al. Molecular expression patterns in the synovium and their association with advanced symptomatic knee osteoarthritis[J]. Osteoarthritis Cartilage, 2019, 27(4): 667-675. |
| 34 | YANG S, KIM J, RYU J H, et al. Hypoxia-inducible factor-2α is a catabolic regulator of osteoarthritic cartilage destruction[J]. Nat Med, 2010, 16(6): 687-693. |
| 35 | QIN Y Y, LI M, FENG X, et al. Combined NADPH and the NOX inhibitor apocynin provides greater anti-inflammatory and neuroprotective effects in a mouse model of stroke[J]. Free Radic Biol Med, 2017, 104: 333-345. |
| 36 | CORYELL P R, DIEKMAN B O, LOESER R F. Mechanisms and therapeutic implications of cellular senescence in osteoarthritis[J]. Nat Rev Rheumatol, 2021, 17(1): 47-57. |
| 37 | SAVVIDOU O, MILONAKI M, GOUMENOS S, et al. Glucocorticoid signaling and osteoarthritis[J]. Mol Cell Endocrinol, 2019, 480: 153-166. |
| 38 | SACTA M A, THARMALINGAM B, COPPO M, et al. Gene-specific mechanisms direct glucocorticoid-receptor-driven repression of inflammatory response genes in macrophages[J]. Elife, 2018, 7: e34864. |
| 39 | MIHAILIDOU C, PANAGIOTOU C, KIARIS H, et al. Crosstalk between C/EBP homologous protein (CHOP) and glucocorticoid receptor in lung cancer[J]. Mol Cell Endocrinol, 2016, 436: 211-223. |
| 40 | DIBATTISTA J A, MARTEL-PELLETIER J, ANTAKLY T, et al. Reduced expression of glucocorticoid receptor levels in human osteoarthritic chondrocytes. Role in the suppression of metalloprotease synthesis[J]. J Clin Endocrinol Metab, 1993, 76(5): 1128-1134. |
| 41 | PELLETIER J P, DIBATTISTA J A, RANGER P, et al. Modulation of the expression of glucocorticoid receptors in synovial fibroblasts and chondrocytes by prostaglandins and NSAIDs[J]. Am J Ther, 1996, 3(2): 115-119. |
| 42 | ZHANG F J, LUO W, LEI G H. Role of HIF-1α and HIF-2α in osteoarthritis[J]. Joint Bone Spine, 2015, 82(3): 144-147. |
| 43 | HU S L, ZHANG C W, NI L B, et al. Stabilization of HIF-1α alleviates osteoarthritis via enhancing mitophagy[J]. Cell Death Dis, 2020, 11(6): 481. |
| 44 | OKADA K, MORI D, MAKII Y, et al. Hypoxia-inducible factor-1 α maintains mouse articular cartilage through suppression of NF-κB signaling[J]. Sci Rep, 2020, 10(1): 5425. |
| 45 | BOUAZIZ W, SIGAUX J, MODROWSKI D, et al. Interaction of HIF1α and β-catenin inhibits matrix metalloproteinase 13 expression and prevents cartilage damage in mice[J]. Proc Natl Acad Sci USA, 2016, 113(19): 5453-5458. |
| 46 | ZHANG H, WANG L, CUI J, et al. Maintaining hypoxia environment of subchondral bone alleviates osteoarthritis progression[J]. Sci Adv, 2023, 9(14): eabo7868. |
| 47 | ZHANG X A, KONG H. Mechanism of HIFs in osteoarthritis[J]. Front Immunol, 2023, 14: 1168799. |
| 48 | PATTERSON A M, CARTWRIGHT A, DAVID G, et al. Differential expression of syndecans and glypicans in chronically inflamed synovium[J]. Ann Rheum Dis, 2008, 67(5): 592-601. |
| 49 | KAUFMAN J, CARIC D, VUKOJEVIC K. Expression pattern of Syndecan-1 and HSP-70 in hip tissue of patients with osteoarthritis[J]. J Orthop, 2019, 17: 134-138. |
| 50 | SALMINEN-MANKONEN H, SÄÄMÄNEN A M, JALKANEN M, et al. Syndecan-1 expression is upregulated in degenerating articular cartilage in a transgenic mouse model for osteoarthritis[J]. Scand J Rheumatol, 2005, 34(6): 469-474. |
| 51 | ZHANG Y Q, YANG Y, WANG C Z, et al. Identification of diagnostic biomarkers of osteoarthritis based on multi-chip integrated analysis and machine learning[J]. DNA Cell Biol, 2020, 39(12): 2245-2256. |
| 52 | HAN Y, WU J, GONG Z, et al. Identification and development of a novel 5-gene diagnostic model based on immune infiltration analysis of osteoarthritis[J]. J Transl Med, 2021, 19(1): 522. |
| 53 | JAIME P, GARCÍA-GUERRERO N, ESTELLA R, et al. CD56+/CD16- natural killer cells expressing the inflammatory protease granzyme A are enriched in synovial fluid from patients with osteoarthritis[J]. Osteoarthritis Cartilage, 2017, 25(10): 1708-1718. |
| 54 | WANG H, ZENG Y, ZHANG M, et al. CD56brightCD16- natural killer cells are shifted toward an IFN-γ-promoting phenotype with reduced regulatory capacity in osteoarthritis[J]. Hum Immunol, 2019, 80(10): 871-877. |
| 55 | MORADI B, SCHNATZER P, HAGMANN S, et al. CD4+ CD25⁺/highCD127low/⁻ regulatory T cells are enriched in rheumatoid arthritis and osteoarthritis joints: analysis of frequency and phenotype in synovial membrane, synovial fluid and peripheral blood[J]. Arthritis Res Ther, 2014, 16(2): R97. |
| 56 | LI Y S, LUO W, ZHU S A, et al. T cells in osteoarthritis: alterations and beyond[J]. Front Immunol, 2017, 8: 356. |
| 57 | CHEN K, KOLLS J K. T cell-mediated host immune defenses in the lung[J]. Annu Rev Immunol, 2013, 31: 605-633. |
| 58 | REN W K, LIU G, CHEN S, et al. Melatonin signaling in T cells: functions and applications[J]. J Pineal Res, 2017, 62(3): e12394. |
| 59 | ZHANG L, LI Y G, LI Y H, et al. Increased frequencies of Th22 cells as well as Th17 cells in the peripheral blood of patients with ankylosing spondylitis and rheumatoid arthritis[J]. PLoS One, 2012, 7(4): e31000. |
| 60 | DOLHAIN R J E M, van der HEIDEN A N, TER HAAR N T, et al. Shift toward T lymphocytes with a T helper 1 cytokine-secretion profile in the joints of patients with rheumatoid arthritis[J]. Arthritis Rheum, 1996, 39(12): 1961-1969. |
| 61 | NEES T A, ZHANG J A, PLATZER H, et al. Infiltration profile of regulatory T cells in osteoarthritis-related pain and disability[J]. Biomedicines, 2022, 10(9): 2111. |
| 62 | KELLY P A, BURCKART G J, VENKATARAMANAN R. Tacrolimus: a new immunosuppressive agent[J]. Am J Health Syst Pharm, 1995, 52(14): 1521-1535. |
| 63 | KITAHARA K, KAWAI S. Cyclosporine and tacrolimus for the treatment of rheumatoid arthritis[J]. Curr Opin Rheumatol, 2007, 19(3): 238-245. |
| 64 | BAGRI N K. Cyclosporine for systemic onset juvenile idiopathic arthritis: current stand and future directions[J]. Indian J Pediatr, 2019, 86(7): 576-577. |
| 65 | MANEIX L, BEAUCHEF G, SERVENT A, et al. 17β-oestradiol up-regulates the expression of a functional UDP-glucose dehydrogenase in articular chondrocytes: comparison with effects of cytokines and growth factors[J]. Rheumatology (Oxford), 2008, 47(3): 281-288. |
| 66 | CLAASSEN H, SCHÜNKE M, KURZ B. Estradiol protects cultured articular chondrocytes from oxygen-radical-induced damage[J]. Cell Tissue Res, 2005, 319(3): 439-445. |
| 67 | PANG H W, CHEN S H, KLYNE D M, et al. Low back pain and osteoarthritis pain: a perspective of estrogen[J]. Bone Res, 2023, 11(1): 42. |
| [1] | Gong Jian, Han Jiyu, Wan Daqian. Research progress in role of T helper 17 cells and interleukin-17 in occurrence and development of osteoarthritis under regulation of gut microbiota [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(6): 815-823. |
| [2] | Wang Yiran, Zhang Zhe, Shen Jianfeng. Comprehensive analysis of the function, prognosis, and immune infiltration characteristics of SF3B1 mutations in uveal melanoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(4): 475-485. |
| [3] | Li Ziyu, Zhu Zeyu, Qian Jiakang, Chen Yulu, Lu Jiayu. Construction of a rat model of temporomandibular joint osteoarthritis induced by monosodium iodoacetate [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(1): 82-89. |
| [4] | WEI Xiang, WEI Lingfei, XU Chunfeng, GAO Yujie, NIE Ping, YU Dedong. Efficacy of photo-crosslinked gelatin hydrogel scaffolds loaded with tauroursodeoxycholic acid on knee cartilage defect repair in a rabbit model [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(7): 829-837. |
| [5] | CHEN Rong, ZHANG Meng, ZHU Diqi, GUO Ying, SHEN Jie. Nomogram for predicting the risk of coronary artery lesions in patients with Kawasaki disease based on anti-neutrophil cytoplasmic antibodies [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(4): 459-467. |
| [6] | LIU Chuxuan, ZUO Jiaxin, XIONG Ping. A nomogram based on ultrasound scoring parameters and clinical indicators for differentiating primary Sjὅgren′s syndrome from IgG4-related sialadenitis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(3): 373-380. |
| [7] | DUN Yiting, ZHAO Jing, FENG Chengling, LI Xingjian, CUI Di, HAN Bangmin. Online risk calculator and nomogram prediction model for urinary incontinence after robot-assisted laparoscopic radical prostatectomy [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(10): 1361-1371. |
| [8] | LU Jiaping, LIU Xing, ZHANG Linshan, ZHAO Lin, ZHANG Min, LI Xiaoying, LIU Yuejun. Relationship between abdominal fat area and first-phase insulin secretion function of pancreatic β-cells in patients with type 2 diabetes [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(1): 42-50. |
| [9] | WEI Yunxin, JIANG Xushun, CAI Mengyao, WEN Ruizhi, DU Xiaogang. Correlation analysis of COMP and autophagy in diabetic nephropathy and its functional verification [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(7): 847-858. |
| [10] | WANG Xin, WANG Xiaoxia, LI Yanqing, ZHENG Yongxin, WU Jie, REN Meng, JIA Xiangdong, XU Tianxiang. Expression and clinical significance of geranylgeranyl diphosphate synthase1 (GGPS1) in lung squamous cell carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(3): 312-324. |
| [11] | HONG Yang, WANG Jie, ZHANG Xiafen, ZHAO Dan, CHENG Min. Efficacy of smart wearable device BPMpathway in home rehabilitation of patients after total knee arthroplasty [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(3): 342-349. |
| [12] | YANG Jingyu, CHEN Liubao, WANG Kangtai, YANG Xingzhi, YU Haitao. Establishment and evaluation of nomogram for differential diagnosis of systemic lupus erythematosus based on laboratory indications [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(2): 204-211. |
| [13] | YU Siwei, XU Ziqi, TAO Mengyu, FAN Guangjian. Mechanistic study on the promotion of pancreatic cancer progression through upregulation of ZNF143 by dysregulated fatty acid metabolism [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(10): 1255-1265. |
| [14] | DU Shaoqian, TAO Mengyu, CAO Yuan, WANG Hongxia, HU Xiaoqu, FAN Guangjian, ZANG Lijuan. CXCL9 expression in breast cancer and its correlation with the characteristics of tumor immunoinfiltration [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(7): 860-872. |
| [15] | LI Qinglin, WANG Wenbo, LIU Wei. Bioinformatics analysis of pathological mechanism of degenerated tendon via stress deprivation [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(5): 560-570. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||