Study on the developmental function of CT14 using the model organism Caenorhabditis elegans

doi:10.3969/j.issn.1674-8115.2024.07.008

Abstract

Abstract:

Objective ·To investigate the effects of the cancer-testis antigen 14 (CT14) on embryonic and larval development in nematodes by using the model organism Caenorhabditis elegans (C. elegans), aiming to uncover its potential functions and mechanisms during development. Methods ·Transgenic C. elegans strains were constructed by using microinjection for the inducible expression of human CT14 (HsCT14), a truncated mutant of CT14 (HsCT14_?CIR) lacking CT14-specific intermediate region (CIR), and a green fluorescent protein (GFP) control. The impacts of full-length and truncated mutant CT14 on nematode embryonic and larval development were analyzed and compared. Additionally, transgenic C. elegans strains with inducible expression of CT14 from various primates, including the crab-eating macaque (Macaca fascicularis) and mouse lemur (Microcebus murinus), were also constructed to assess the effects on egg hatching and larval-to-adult transformation rates. The differential gene expression in nematode embryos induced by CT14 was analyzed by Smart-seq transcriptome sequencing, with further insights gained through KEGG (Kyoto Encyclopedia of Genes and Genomes) and GSEA (Gene Set Enrichment Analysis), to explore the involved biological processes and pathways. Results ·The induced expression of HsCT14 and its truncated mutant HsCT14_?CIR significantly reduced the hatching rate of nematode eggs, with a more pronounced effect observed in HsCT14-expressing strains. Differential interference contrast (DIC) microscopy imaging revealed significant morphological abnormalities in embryos expressing HsCT14 during the comma stage. Nematodes expressing HsCT14 or HsCT14_?CIR exhibited developmental arrest in larvae and substantially lower larval-to-adult transformation rates compared to the GFP control. The impact was more pronounced in nematodes expressing HsCT14 than those with HsCT14_?CIR. The expression of Macaca fascicularis CT14 (MfCT14) exhibited significant effects on the hatching rate and adult transformation rate, similar to that of HsCT14, while the expression of Microcebus murinus CT14 (MmCT14) displayed significantly reduced impact compared to HsCT14 and MfCT14. Smart-seq results indicated that CT14 expression affected various biological processes in nematode embryos, related to ATP-dependent chromatin remodeling and DNA replication. Conclusion ·Ectopic expression of the cancer-testis antigen CT14 significantly disrupts both embryonic and larval developments in C. elegans, with the CIR sequence substantially enhancing this effect. It suggests that CT14 may play an important regulatory role in biological development by affecting gene expression in multiple pathways, including chromatin remodeling.

Key words: cancer-testis antigen, cancer-testis antigen 14 (CT14), Caenorhabditis elegans, embryonic development, larval development

CLC Number:

R714.51

YANG Shuwen, CHEN Juan, YANG Qin, LEI Ming, HUANG Chenhui. Study on the developmental function of CT14 using the model organism Caenorhabditis elegans[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(7): 871-882.

Figures/Tables 7

Tab 1 Sequences of primers for qPCR

Gene	Forward sequence (5′→3′)	Reverse sequence (5′→3′)
CT14	GTCACCTGAGAAAGGTGAAGCAC	GTCACCTGAGAAAGGTGAAGCAC
GFP	CTGTTCCATGGCCAACACTTG	CTGTTCCATGGCCAACACTTG
Act-1	CCAGGAATTGCTGATCGTATG	GGAGAGGGAAGCGAGGATAG

Fig 1 Inducible expression of CT14 in transgenic C. elegans strains

Fig 2 Hatching phenotype of transgenic nematodes

Fig 3 Morphological characterization of embryonic development in transgenic nematodes

Fig 4 Inhibitory effects of ectopic CT14 expression on nematode larval development

Fig 5 Impacts of the expression of CT14 homologs from different primates on egg hatching and larval developmentin C.elegans

Fig 6 Effects of ectopic expression of CT14 on the regulation of gene expression, the TGF-β pathway and DNA replication in C. elegans embryos

TrendMD

References 28

1	GORDEEVA O. Cancer-testis antigens: unique cancer stem cell biomarkers and targets for cancer therapy[J]. Semin Cancer Biol, 2018, 53: 75-89.
2	FAN C M, QU H K, WANG X, et al. Cancer/testis antigens: from serology to mRNA cancer vaccine[J]. Semin Cancer Biol, 2021, 76: 218-231.
3	ZHANG G H, JIANG C, YANG Y S, et al. Deficiency of cancer/testis antigen gene CT55 causes male infertility in humans and mice[J]. Cell Death Differ, 2023, 30(2): 500-514.
4	LIU W S, LU C, MISTRY B V. Subcellular localization of the mouse PRAMEL1 and PRAMEX1 reveals multifaceted roles in the nucleus and cytoplasm of germ cells during spermatogenesis[J]. Cell Biosci, 2021, 11(1): 102.
5	SCHÄFER P, PARASCHIAKOS T, WINDHORST S. Oncogenic activity and cellular functionality of melanoma associated antigen A3[J]. Biochem Pharmacol, 2021, 192: 114700.
6	NIN D S, DENG L W. Biology of cancer-testis antigens and their therapeutic implications in cancer[J]. Cells, 2023, 12(6): 926.
7	YANG P, MENG M, ZHOU Q S. Oncogenic cancer/testis antigens are a hallmarker of cancer and a sensible target for cancer immunotherapy[J]. Biochim Biophys Acta Rev Cancer, 2021, 1876(1): 188558.
8	ZHANG Y J, YU X H, LIU Q P, et al. SAGE1: a potential target antigen for lung cancer T-cell immunotherapy[J]. Mol Cancer Ther, 2021, 20(11): 2302-2313.
9	YANG Y, QU Y J, LI Z P, et al. Identification of novel characteristics in TP53-mutant hepatocellular carcinoma using bioinformatics[J]. Front Genet, 2022, 13: 874805.
10	ISHIHARA M, KAGEYAMA S, MIYAHARA Y, et al. MAGE-A4, NY-ESO-1 and SAGE mRNA expression rates and co-expression relationships in solid tumours[J]. BMC Cancer, 2020, 20(1): 606.
11	PACKER J S, ZHU Q, HUYNH C, et al. A lineage-resolved molecular atlas of C. elegans embryogenesis at single-cell resolution[J]. Science, 2019, 365(6459): eaax1971.
12	ALJOHANI M D, MOURIDI S E, PRIYADARSHINI M, et al. Engineering rules that minimize germline silencing of transgenes in simple extrachromosomal arrays in C. elegans[J]. Nat Commun, 2020, 11(1): 6300.
13	KIMBLE J, NÜSSLEIN-VOLHARD C. The great small organisms of developmental genetics: Caenorhabditis elegans and Drosophila melanogaster[J]. Dev Biol, 2022, 485: 93-122.
14	AZUMA Y, OKADA H, ONAMI S. Systematic analysis of cell morphodynamics in C. elegans early embryogenesis[J]. Front Bioinform, 2023, 3: 1082531.
15	YAN L Y, YANG M Y, GUO H S, et al. Single-cell RNA-Seq profiling of human preimplantation embryos and embryonic stem cells[J]. Nat Struct Mol Biol, 2013, 20(9): 1131-1139.
16	MAO S S, QI Y C, ZHU H H, et al. A tet/Q hybrid system for robust and versatile control of transgene expression in C.elegans[J]. iScience, 2019, 11: 224-237.
17	VAN DER VAART A, GODFREY M, PORTEGIJS V, et al. Dose-dependent functions of SWI/SNF BAF in permitting and inhibiting cell proliferation in vivo[J]. Sci Adv, 2020, 6(21): 3823.
18	COHEN I, BAR C, LIU H Q, et al. Polycomb complexes redundantly maintain epidermal stem cell identity during development[J]. Genes Dev, 2021, 35(5/6): 354-366.
19	ROSS J M, ZARKOWER D. Polycomb group regulation of Hox gene expression in C. elegans[J]. Dev Cell, 2003, 4(6): 891-901.
20	ERDELYI P, WANG X, SULESKI M, et al. A network of chromatin factors is regulating the transition to postembryonic development in Caenorhabditis elegans[J]. G3, 2017, 7(2): 343-353.
21	SAVAGE-DUNN C, PADGETT R W. The TGF-β family in Caenorhabditis elegans[J]. Cold Spring Harb Perspect Biol, 2017, 9(6): a022178.
22	NAYAK S, SANTIAGO F E, JIN H, et al. The Caenorhabditis elegans Skp1-related gene family: diverse functions in cell proliferation, morphogenesis, and meiosis[J]. Curr Biol, 2002, 12(4): 277-287.
23	BRASHEAR W A, BREDEMEYER K R, MURPHY W J. Genomic architecture constrained placental mammal X Chromosome evolution[J]. Genome Res, 2021, 31(8): 1353-1365.
24	VOCKEL M, RIERA-ESCAMILLA A, TÜTTELMANN F, et al. The X chromosome and male infertility[J]. Hum Genet, 2021, 140(1): 203-215.
25	JIA Y, CHENG Z X, BHARATH S R, et al. Crystal structure of the INTS3/INTS6 complex reveals the functional importance of INTS3 dimerization in DSB repair[J]. Cell Discov, 2021, 7(1): 66.
26	ZHENG H, QI Y L, HU S B, et al. Identification of Integrator-PP2A complex (INTAC), an RNA polymerase Ⅱ phosphatase[J]. Science, 2020, 370(6520): eabb5872.
27	LAI F, GARDINI A, ZHANG A D, et al. Integrator mediates the biogenesis of enhancer RNAs[J]. Nature, 2015, 525(7569): 399-403.
28	BAILLAT D, HAKIMI M A, NÄÄR A M, et al. Integrator, a multiprotein mediator of small nuclear RNA processing, associates with the C-terminal repeat of RNA polymerase Ⅱ[J]. Cell, 2005, 123(2): 265-276.

[1]	XUE Yu, ZHANG Hailong, LEI Ming. Expression of cancer-testis antigen SPANXB and its mechanism in affecting hepatocellular carcinoma progress [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(7): 801-813.
[2]	WANG Zhiming, TONG Ran, YANG Chen, JIAO Huiyuan, WANG Yihao, LI Linying, WANG Yexin, ZHANG Feng, LI Lingjie. Quantitative analysis of the developmental potential of cells and tissues based on evolutionary conservation of genes and regulatory regions [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(11): 1384-1395.
[3]	WANG Jing, LI Fen . Research advances in transcription factor AP-2 in embryonic and cardiovascular development [J]. , 2016, 36(11): 1658-.
[4]	ZHANG Tao, YUAN Hao, LIU Xi, et al. Function and mechanism of death domain-associated protein in zebrafish embryonic development [J]. , 2013, 33(11): 1458-.