Trend analysis of differentially expressed genes in retinoic acid-induced neural tube defects in mouse model

doi:10.3969/j.issn.1674-8115.2024.07.007

Abstract

Abstract:

Objective ·To explore the molecular regulatory mechanism of neural tube defect (NTD) induced by retinoic acid (RA) in mouse embryos, and reveal the gene expression regularity of neural tube closure in mice. Methods ·Based on the high-quality brain vesicle transcriptome data of mouse embryo during the critical period of neural tube closure [embryonic day 8.5 (E8.5), E9.5 and E10.5], the gene expression trend data of the NTD group and the control group were obtained by using Short Time-series Expression Miner (STEM) software. Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis were performed for genes with different expression trends between the NTD group and the control group. Some candidate genes were screened for validation. Pregnant mice were divided into the NTD group and control group, with 9 mice in each group. Pregnant mice in the NTD group were treated with RA and those in the control group were treated with sesame oil by gavage at E7.5. Foetal rat brain vesicle tissues were collected at E8.5, E9.5 and E10.5 for experiments. Based on the above animal tissues, the screened candidate genes were validated by quantitative real-time PCR (RT-PCR). Results ·A total of 18 255 genes were detected in the transcriptome data of the control group, and the expression patterns of these genes could be summarized into 7 significant profiles. A total of 19 037 gene expression data were detected in the transcriptome data of the NTD group, and gene expression patterns could be summarized into 6 profiles with significant significance. A total of 46 genes in the control group showed an upward trend but a downward trend in the NTD group. They were enriched in the positive and negative regulation of organ development, neuronal apoptosis, oligodendrocyte proliferation, and fibroblast growth factor signaling pathway at the biological process level. At the cellular component level, they were mainly involved in the basic structure of cells and neurons; At the molecular functional level, they were mainly related to the binding of fibroblast growth factor receptor. A total of 61 genes showed a downward trend in the control group but an upward trend in the NTD group. These genes were enriched in functions such as cell lysis and amino acid/ion transport at the biological process level. At the cellular component level, they were enriched in intracellular molecules, particles, extracellular region, intercellular space, etc. At the molecular function level, they were related to the activity of a series of enzymes and transporters. The results of RT-qPCR showed that the transcriptome sequencing data were authentic and reliable. Conclusion ·RA intervention causes abnormal cellular activities and stress responses during mouse embryo development, leading to abnormal embryo development, activation of signalling pathways related to organismal self-protection, and suppression of genes that maintain normal embryo development.

Key words: retinoic acid, neural tube defect, gene expression, trend analysis

CLC Number:

R322.81

CAO Rui, WEI Kaixin, ZHANG Xiaona, LIU Yurong, ZHANG Li. Trend analysis of differentially expressed genes in retinoic acid-induced neural tube defects in mouse model[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(7): 859-870.

Figures/Tables 7

Tab 1 RT-qPCR primer sequences

Gene name	Gene ID	Primer type	Primer sequence (5′→3′)
Vax1	22326	Forward	AAGAAGGACCAGGGCAAGGACTC
Vax1	22326	Reverse	GCACAGGGCGGCAGCAAG
Foxf2	14238	Forward	CGCCACAACCTCTCGCTCAAC
Foxf2	14238	Reverse	GCGGAACGAACCCTCCTCAAAC
Ptprz1	19283	Forward	GTCACCACCACCAAGTATGCTACC
Ptprz1	19283	Reverse	AAACTGCCCACGCTTTAGATCCTG
Stc2	20856	Forward	GCAGGAAGTGTCCAGCAATTAGG
Stc2	20856	Reverse	GCAGGTTCACAAGGTCCACATAG
Slc7a3	11989	Forward	TGTCCATTTGTGTTCTCATCCTCAG
Slc7a3	11989	Reverse	GCTTCTCTGCTTCAAGTGTCTCC
Fgf1	14164	Forward	TTATACGGCTCGCAGACACC
Fgf1	14164	Reverse	TCTGGCCATAGTGAGTCCGA

Fig 1 Development of mouse embryos in the control group and the NTD group at E8.5, E9.5 and E10.5

Fig 2 Significant gene expression patterns in the control group

Fig 3 Significant gene expression patterns in the NTD group

Fig 4 Overview of gene sets with differential expression trend between the control group and the NTD group

Fig 5 Enrichment results of gene function with different expression trend between the control group and the NTD group

Fig 6 Expression levels of candidate genes detected by RT-qqPCR in the control group and the NTD group at E8.5, E9.5 and E10.5

TrendMD

References 32

1	ISAKOVIĆ J, ŠIMUNIĆ I, JAGEČIĆ D, et al. Overview of neural tube defects: gene-environment interactions, preventative approaches and future perspectives[J]. Biomedicines, 2022, 10(5): 965.
2	KANCHERLA V. Neural tube defects: a review of global prevalence, causes, and primary prevention[J]. Childs Nerv Syst, 2023, 39(7): 1703-1710.
3	RAYON T, STAMATAKI D, PEREZ-CARRASCO R, et al. Species-specific pace of development is associated with differences in protein stability[J]. Science, 2020, 369(6510): eaba7667.
4	ZAGANJOR I, SEKKARIE A, TSANG B L, et al. Describing the prevalence of neural tube defects worldwide: a systematic literature review[J]. PLoS One, 2016, 11(4): e0151586.
5	KANG L Y, GUO Z R, SHANG W J, et al. Perinatal prevalence of birth defects in the Mainland of China, 2000—2021: a systematic review and meta-analysis[J]. World J Pediatr, 2024. DOI: 10.1007/s12519-023-00786-8.
6	MOORE C A, LI S, LI Z, et al. Elevated rates of severe neural tube defects in a high-prevalence area in northern China[J]. Am J Med Genet, 1997, 73(2): 113-118.
7	LI Z W, REN A G, ZHANG L, et al. Extremely high prevalence of neural tube defects in a 4-county area in Shanxi Province, China[J]. Birth Defects Res A Clin Mol Teratol, 2006, 76(4): 237-240.
8	VAN GOOL J D, HIRCHE H, LAX H, et al. Folic acid and primary prevention of neural tube defects: a review[J]. Reprod Toxicol, 2018, 80: 73-84.
9	YU J, WANG L, PEI P, et al. Reduced H3K27me3 leads to abnormal Hox gene expression in neural tube defects[J]. Epigenetics Chromatin, 2019, 12(1): 76.
10	ERNST J, BAR-JOSEPH Z. STEM: a tool for the analysis of short time series gene expression data[J]. BMC Bioinformatics, 2006, 7: 191.
11	CAO R, LI J Q, ZHANG L, et al. Analysis of genes associated with both neural tube defects and neuroectodermal tumors[J]. Med Sci Monit, 2022, 28: e936079.
12	SUN Y Q, ZHANG J, WANG Y F, et al. miR-222-3p is involved in neural tube closure by directly targeting Ddit4 in RA induced NTDs mouse model[J]. Cell Cycle, 2021, 20(22): 2372-2386.
13	CHAI Z, YANG L H, YU B F, et al. p38 mitogen-activated protein kinase-dependent regulation of SRC-3 and involvement in retinoic acid receptor α signaling in embryonic cortical neurons[J]. IUBMB Life, 2009, 61(6): 670-678.
14	LIU J G, ZHOU R, HE Q R, et al. Calmodulin kinase Ⅱ activation of mitogen-activated protein kinase in PC12 cell following all-trans retinoic acid treatment[J]. Neurotoxicology, 2009, 30(4): 599-604.
15	EAGLESON G, FERREIRO B, HARRIS W A. Fate of the anterior neural ridge and the morphogenesis of the Xenopus forebrain[J]. J Neurobiol, 1995, 28(2): 146-158.
16	HALLONET M, HOLLEMANN T, WEHR R, et al. Vax1 is a novel homeobox-containing gene expressed in the developing anterior ventral forebrain[J]. Development, 1998, 125(14): 2599-2610.
17	PENG L, NIU Z M, CHEN J P, et al. Association of genetic polymorphisms of VAX1, MAFB, and NTN1 with nonsyndromic cleft lip with or without cleft palate in Chinese population[J]. Mol Genet Genomics, 2022, 297(2): 553-559.
18	HE W H, KANG Y B, ZHU W, et al. FOXF2 acts as a crucial molecule in tumours and embryonic development[J]. Cell Death Dis, 2020, 11(6): 424.
19	EVERSON J L, FINK D M, YOON J W, et al. Sonic hedgehog regulation of Foxf2 promotes cranial neural crest mesenchyme proliferation and is disrupted in cleft lip morphogenesis[J]. Development, 2017, 144(11): 2082-2091.
20	WU Q, LI W, YOU C G. The regulatory roles and mechanisms of the transcription factor FOXF2 in human diseases[J]. PeerJ, 2021, 9: e10845.
21	XIA Z, OUYANG D, LI Q, et al. The expression, functions, interactions and prognostic values of PTPRZ1: a review and bioinformatic analysis[J]. J Cancer, 2019, 10(7): 1663-1674.
22	KUBOYAMA K, FUJIKAWA A, SUZUKI R, et al. Role of chondroitin sulfate (CS) modification in the regulation of protein-tyrosine phosphatase receptor type Z (PTPRZ) activity: pleiotrophin-PTPRZ-A signaling is involved in oligodendrocyte differentiation[J]. J Biol Chem, 2016, 291(35): 18117-18128.
23	KLAUSMEYER A, GARWOOD J, FAISSNER A. Differential expression of phosphacan/RPTPβ isoforms in the developing mouse visual system[J]. J Comp Neurol, 2007, 504(6): 659-679.
24	ROLL L, LESSMANN K, BRÜSTLE O, et al. Cerebral organoids maintain the expression of neural stem cell-associated glycoepitopes and extracellular matrix[J]. Cells, 2022, 11(5): 760.
25	PASTOR M, FERNÁNDEZ-CALLE R, GERONIMO B D, et al. Development of inhibitors of receptor protein tyrosine phosphatase β/ζ (PTPRZ1) as candidates for CNS disorders[J]. Eur J Med Chem, 2018, 144: 318-329.
26	QIE S, SANG N. Stanniocalcin 2 (STC2): a universal tumour biomarker and a potential therapeutical target[J]. J Exp Clin Cancer Res, 2022, 41(1): 161.
27	JEON Y, SHIN J E, KWON M, et al. In vivo gene delivery of STC2 promotes axon regeneration in sciatic nerves[J]. Mol Neurobiol, 2021, 58(2): 750-760.
28	CAO Y Z, JIA Q H, XING Y X, et al. STC2 inhibits hepatic lipid synthesis and correlates with intramuscular fatty acid composition, body weight and carcass traits in chickens[J]. Animals, 2024, 14(3): 383.
29	GAO H J, WU G Y, SPENCER T E, et al. Select nutrients in the ovine uterine lumen. Ⅲ. Cationic amino acid transporters in the ovine uterus and peri-implantation conceptuses[J]. Biol Reprod, 2009, 80(3): 602-609.
30	KIM J J, KHALID O, NAMAZI A, et al. Discovery of consensus gene signature and intermodular connectivity defining self-renewal of human embryonic stem cells[J]. Stem Cells, 2014, 32(6): 1468-1479.
31	KOKKONEN H, SIREN A, MÄÄTTÄ T, et al. Identification of microduplications at Xp21.2 and Xq13.1 in neurodevelopmental disorders[J]. Mol Genet Genomic Med, 2021, 9(12): e1703.
32	NURCOMBE V, FORD M D, WILDSCHUT J A, et al. Developmental regulation of neural response to FGF-1 and FGF-2 by heparan sulfate proteoglycan[J]. Science, 1993, 260(5104): 103-106.

[1]	SUN Siyuan, LIU Yuanqi, CUI Yiwen, HUANG Zihan, MEI Li, DAI Qinggang, JIANG Lingyong. Generation and validation of the conditional osteoblast-specific retinoic acid signaling inhibition mouse model [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(6): 676-686.
[2]	HOU Zongliang, YANG Qin, LI Shaobai, LEI Ming. Gene expression program analysis of cancer-testis genes [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(8): 945-954.
[3]	HAN Xiaxia, JIANG Yang, GU Shuangshuang, DAI Dai, SHEN Nan. Transcriptomic analysis of metabolic characteristics of the immune cells in systemic lupus erythematosus patients [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(9): 1197-1207.
[4]	HU Jiacheng, ZHU Qian, WANG Jiaqi, WU Yingli, LEI Hu. Function of UCHL3 in maintaining the survival of FLT3-ITD positive acute myeloid leukemia cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(10): 1383-1393.
[5]	Jianru WANG, Guangcao PENG, Mingjun ZHU. Screening potential hub genes associated with myocardial ischemia-reperfusion injury in mice based on GEO database and bioinformatics analysis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(1): 51-62.
[6]	Yu-chen LI, Li-lian BAI, He-feng HUANG, Xin-mei LIU. Single-cell transcriptomic analysis of development and involution of human thymic stroma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(7): 865-875.
[7]	Yu-huan WANG, Yi-cen DING, Yao-yu CAI, Ya-ni KANG. Study on differentially expressed microRNA as a biomarker of polycystic ovary syndrome [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(11): 1429-1435.
[8]	LI Chao, MI Jian-qing, WANG Jin. Advances in Philadelphia chromosome-like acute lymphoblastic leukemia [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(9): 1294-1301.
[9]	JIAN Fang-fang1, CHE Xiao-xia2, FENG Wei-wei1. Bioinformatics analysis of expression profiles of long noncoding RNA in endometrial cancer [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(6): 768-775.
[10]	JING Bo, CHEN Peng-hui, GAO Xiang, XU Yuan-yuan, WU Yun-zhao, SUN Yun, WU Ying-li . Establishment of cell-based screening system for compound regulating the stability of retinoic acid receptors [J]. , 2017, 37(4): 432-.
[11]	LIU Zu-yin, LI Qing, CHEN Li-jun, et al. Inhibition of adipogenic differentiation of bone marrow mesenchymal stem cells by all-trans retinoic acid through direct regulation of PPARγ2 by RARγ [J]. , 2015, 35(5): 682-.
[12]	CHEN Li-jun, REN Lan, LIU Zu-yin, et al. Effects of marginal vitamin A deficiency in pregnancy on expressions of retinoic acid receptor alpha, Src, and NMDAR1 of newborn rats [J]. , 2015, 35(4): 500-.
[13]	GAO You-shui, SUN Yu-qiang, ZHANG Chang-qing. Advances of preventive and therapeutic strategies for acquired heterotopic ossification [J]. , 2014, 34(6): 934-.
[14]	LI Shao-bo, FU Guo-hui. RNA-Seq based analysis on cSNP and gene expression level [J]. , 2014, 34(2): 129-.
[15]	HE Wei, HUANG Ying. Dependency of intranuclear mobility of PLZF-RARα fusion proteins on ligand and its transcription activity revealed by FRAP [J]. , 2014, 34(10): 1463-.