
Journal of Shanghai Jiao Tong University (Medical Science) ›› 2024, Vol. 44 ›› Issue (7): 859-870.doi: 10.3969/j.issn.1674-8115.2024.07.007
• Basic research • Previous Articles Next Articles
CAO Rui1,2(
), WEI Kaixin3, ZHANG Xiaona3, LIU Yurong3, ZHANG Li3,4(
)
Received:2024-01-06
Accepted:2024-03-25
Online:2024-07-28
Published:2024-07-28
Contact:
ZHANG Li
E-mail:caorui@d.sxmu.edu.cn;zhangli3788@163.com
Supported by:CLC Number:
CAO Rui, WEI Kaixin, ZHANG Xiaona, LIU Yurong, ZHANG Li. Trend analysis of differentially expressed genes in retinoic acid-induced neural tube defects in mouse model[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(7): 859-870.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2024.07.007
| Gene name | Gene ID | Primer type | Primer sequence (5′→3′) |
|---|---|---|---|
| Vax1 | 22326 | Forward | AAGAAGGACCAGGGCAAGGACTC |
| Reverse | GCACAGGGCGGCAGCAAG | ||
| Foxf2 | 14238 | Forward | CGCCACAACCTCTCGCTCAAC |
| Reverse | GCGGAACGAACCCTCCTCAAAC | ||
| Ptprz1 | 19283 | Forward | GTCACCACCACCAAGTATGCTACC |
| Reverse | AAACTGCCCACGCTTTAGATCCTG | ||
| Stc2 | 20856 | Forward | GCAGGAAGTGTCCAGCAATTAGG |
| Reverse | GCAGGTTCACAAGGTCCACATAG | ||
| Slc7a3 | 11989 | Forward | TGTCCATTTGTGTTCTCATCCTCAG |
| Reverse | GCTTCTCTGCTTCAAGTGTCTCC | ||
| Fgf1 | 14164 | Forward | TTATACGGCTCGCAGACACC |
| Reverse | TCTGGCCATAGTGAGTCCGA |
Tab 1 RT-qPCR primer sequences
| Gene name | Gene ID | Primer type | Primer sequence (5′→3′) |
|---|---|---|---|
| Vax1 | 22326 | Forward | AAGAAGGACCAGGGCAAGGACTC |
| Reverse | GCACAGGGCGGCAGCAAG | ||
| Foxf2 | 14238 | Forward | CGCCACAACCTCTCGCTCAAC |
| Reverse | GCGGAACGAACCCTCCTCAAAC | ||
| Ptprz1 | 19283 | Forward | GTCACCACCACCAAGTATGCTACC |
| Reverse | AAACTGCCCACGCTTTAGATCCTG | ||
| Stc2 | 20856 | Forward | GCAGGAAGTGTCCAGCAATTAGG |
| Reverse | GCAGGTTCACAAGGTCCACATAG | ||
| Slc7a3 | 11989 | Forward | TGTCCATTTGTGTTCTCATCCTCAG |
| Reverse | GCTTCTCTGCTTCAAGTGTCTCC | ||
| Fgf1 | 14164 | Forward | TTATACGGCTCGCAGACACC |
| Reverse | TCTGGCCATAGTGAGTCCGA |
| 1 | ISAKOVIĆ J, ŠIMUNIĆ I, JAGEČIĆ D, et al. Overview of neural tube defects: gene-environment interactions, preventative approaches and future perspectives[J]. Biomedicines, 2022, 10(5): 965. |
| 2 | KANCHERLA V. Neural tube defects: a review of global prevalence, causes, and primary prevention[J]. Childs Nerv Syst, 2023, 39(7): 1703-1710. |
| 3 | RAYON T, STAMATAKI D, PEREZ-CARRASCO R, et al. Species-specific pace of development is associated with differences in protein stability[J]. Science, 2020, 369(6510): eaba7667. |
| 4 | ZAGANJOR I, SEKKARIE A, TSANG B L, et al. Describing the prevalence of neural tube defects worldwide: a systematic literature review[J]. PLoS One, 2016, 11(4): e0151586. |
| 5 | KANG L Y, GUO Z R, SHANG W J, et al. Perinatal prevalence of birth defects in the Mainland of China, 2000—2021: a systematic review and meta-analysis[J]. World J Pediatr, 2024. DOI: 10.1007/s12519-023-00786-8. |
| 6 | MOORE C A, LI S, LI Z, et al. Elevated rates of severe neural tube defects in a high-prevalence area in northern China[J]. Am J Med Genet, 1997, 73(2): 113-118. |
| 7 | LI Z W, REN A G, ZHANG L, et al. Extremely high prevalence of neural tube defects in a 4-county area in Shanxi Province, China[J]. Birth Defects Res A Clin Mol Teratol, 2006, 76(4): 237-240. |
| 8 | VAN GOOL J D, HIRCHE H, LAX H, et al. Folic acid and primary prevention of neural tube defects: a review[J]. Reprod Toxicol, 2018, 80: 73-84. |
| 9 | YU J, WANG L, PEI P, et al. Reduced H3K27me3 leads to abnormal Hox gene expression in neural tube defects[J]. Epigenetics Chromatin, 2019, 12(1): 76. |
| 10 | ERNST J, BAR-JOSEPH Z. STEM: a tool for the analysis of short time series gene expression data[J]. BMC Bioinformatics, 2006, 7: 191. |
| 11 | CAO R, LI J Q, ZHANG L, et al. Analysis of genes associated with both neural tube defects and neuroectodermal tumors[J]. Med Sci Monit, 2022, 28: e936079. |
| 12 | SUN Y Q, ZHANG J, WANG Y F, et al. miR-222-3p is involved in neural tube closure by directly targeting Ddit4 in RA induced NTDs mouse model[J]. Cell Cycle, 2021, 20(22): 2372-2386. |
| 13 | CHAI Z, YANG L H, YU B F, et al. p38 mitogen-activated protein kinase-dependent regulation of SRC-3 and involvement in retinoic acid receptor α signaling in embryonic cortical neurons[J]. IUBMB Life, 2009, 61(6): 670-678. |
| 14 | LIU J G, ZHOU R, HE Q R, et al. Calmodulin kinase Ⅱ activation of mitogen-activated protein kinase in PC12 cell following all-trans retinoic acid treatment[J]. Neurotoxicology, 2009, 30(4): 599-604. |
| 15 | EAGLESON G, FERREIRO B, HARRIS W A. Fate of the anterior neural ridge and the morphogenesis of the Xenopus forebrain[J]. J Neurobiol, 1995, 28(2): 146-158. |
| 16 | HALLONET M, HOLLEMANN T, WEHR R, et al. Vax1 is a novel homeobox-containing gene expressed in the developing anterior ventral forebrain[J]. Development, 1998, 125(14): 2599-2610. |
| 17 | PENG L, NIU Z M, CHEN J P, et al. Association of genetic polymorphisms of VAX1, MAFB, and NTN1 with nonsyndromic cleft lip with or without cleft palate in Chinese population[J]. Mol Genet Genomics, 2022, 297(2): 553-559. |
| 18 | HE W H, KANG Y B, ZHU W, et al. FOXF2 acts as a crucial molecule in tumours and embryonic development[J]. Cell Death Dis, 2020, 11(6): 424. |
| 19 | EVERSON J L, FINK D M, YOON J W, et al. Sonic hedgehog regulation of Foxf2 promotes cranial neural crest mesenchyme proliferation and is disrupted in cleft lip morphogenesis[J]. Development, 2017, 144(11): 2082-2091. |
| 20 | WU Q, LI W, YOU C G. The regulatory roles and mechanisms of the transcription factor FOXF2 in human diseases[J]. PeerJ, 2021, 9: e10845. |
| 21 | XIA Z, OUYANG D, LI Q, et al. The expression, functions, interactions and prognostic values of PTPRZ1: a review and bioinformatic analysis[J]. J Cancer, 2019, 10(7): 1663-1674. |
| 22 | KUBOYAMA K, FUJIKAWA A, SUZUKI R, et al. Role of chondroitin sulfate (CS) modification in the regulation of protein-tyrosine phosphatase receptor type Z (PTPRZ) activity: pleiotrophin-PTPRZ-A signaling is involved in oligodendrocyte differentiation[J]. J Biol Chem, 2016, 291(35): 18117-18128. |
| 23 | KLAUSMEYER A, GARWOOD J, FAISSNER A. Differential expression of phosphacan/RPTPβ isoforms in the developing mouse visual system[J]. J Comp Neurol, 2007, 504(6): 659-679. |
| 24 | ROLL L, LESSMANN K, BRÜSTLE O, et al. Cerebral organoids maintain the expression of neural stem cell-associated glycoepitopes and extracellular matrix[J]. Cells, 2022, 11(5): 760. |
| 25 | PASTOR M, FERNÁNDEZ-CALLE R, GERONIMO B D, et al. Development of inhibitors of receptor protein tyrosine phosphatase β/ζ (PTPRZ1) as candidates for CNS disorders[J]. Eur J Med Chem, 2018, 144: 318-329. |
| 26 | QIE S, SANG N. Stanniocalcin 2 (STC2): a universal tumour biomarker and a potential therapeutical target[J]. J Exp Clin Cancer Res, 2022, 41(1): 161. |
| 27 | JEON Y, SHIN J E, KWON M, et al. In vivo gene delivery of STC2 promotes axon regeneration in sciatic nerves[J]. Mol Neurobiol, 2021, 58(2): 750-760. |
| 28 | CAO Y Z, JIA Q H, XING Y X, et al. STC2 inhibits hepatic lipid synthesis and correlates with intramuscular fatty acid composition, body weight and carcass traits in chickens[J]. Animals, 2024, 14(3): 383. |
| 29 | GAO H J, WU G Y, SPENCER T E, et al. Select nutrients in the ovine uterine lumen. Ⅲ. Cationic amino acid transporters in the ovine uterus and peri-implantation conceptuses[J]. Biol Reprod, 2009, 80(3): 602-609. |
| 30 | KIM J J, KHALID O, NAMAZI A, et al. Discovery of consensus gene signature and intermodular connectivity defining self-renewal of human embryonic stem cells[J]. Stem Cells, 2014, 32(6): 1468-1479. |
| 31 | KOKKONEN H, SIREN A, MÄÄTTÄ T, et al. Identification of microduplications at Xp21.2 and Xq13.1 in neurodevelopmental disorders[J]. Mol Genet Genomic Med, 2021, 9(12): e1703. |
| 32 | NURCOMBE V, FORD M D, WILDSCHUT J A, et al. Developmental regulation of neural response to FGF-1 and FGF-2 by heparan sulfate proteoglycan[J]. Science, 1993, 260(5104): 103-106. |
| [1] | LIU Yuanqi, SUN Siyuan, DAI Qinggang, JIANG Lingyong, SHEN Guofang. Dual-directional effect of all-trans retinoic acid on osteogenic differentiation of jaw bone marrow mesenchymal stem cells in vitro [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1083-1093. |
| [2] | SUN Siyuan, LIU Yuanqi, CUI Yiwen, HUANG Zihan, MEI Li, DAI Qinggang, JIANG Lingyong. Generation and validation of the conditional osteoblast-specific retinoic acid signaling inhibition mouse model [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(6): 676-686. |
| [3] | ZHANG Yutong, HOU Guojun, SHEN Nan. Comparison of human-induced pluripotent stem cell-derived macrophages with peripheral blood-derived macrophages using single-cell genomics [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(12): 1477-1489. |
| [4] | HONG Lei, GUO Chuanliang, CAI Qin, LI Wanrui, ZENG Yitao, XUE Yan, ZENG Fanyi. Mechanism of DUX-induced differentiation of mESC into extraembryonic endoderm [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1359-1369. |
| [5] | HOU Zongliang, YANG Qin, LI Shaobai, LEI Ming. Gene expression program analysis of cancer-testis genes [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(8): 945-954. |
| [6] | HAN Xiaxia, JIANG Yang, GU Shuangshuang, DAI Dai, SHEN Nan. Transcriptomic analysis of metabolic characteristics of the immune cells in systemic lupus erythematosus patients [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(9): 1197-1207. |
| [7] | HU Jiacheng, ZHU Qian, WANG Jiaqi, WU Yingli, LEI Hu. Function of UCHL3 in maintaining the survival of FLT3-ITD positive acute myeloid leukemia cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(10): 1383-1393. |
| [8] | Jianru WANG, Guangcao PENG, Mingjun ZHU. Screening potential hub genes associated with myocardial ischemia-reperfusion injury in mice based on GEO database and bioinformatics analysis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(1): 51-62. |
| [9] | Yu-chen LI, Li-lian BAI, He-feng HUANG, Xin-mei LIU. Single-cell transcriptomic analysis of development and involution of human thymic stroma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(7): 865-875. |
| [10] | Yu-huan WANG, Yi-cen DING, Yao-yu CAI, Ya-ni KANG. Study on differentially expressed microRNA as a biomarker of polycystic ovary syndrome [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(11): 1429-1435. |
| [11] | LI Chao, MI Jian-qing, WANG Jin. Advances in Philadelphia chromosome-like acute lymphoblastic leukemia [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(9): 1294-1301. |
| [12] | JIAN Fang-fang1, CHE Xiao-xia2, FENG Wei-wei1. Bioinformatics analysis of expression profiles of long noncoding RNA in endometrial cancer [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(6): 768-775. |
| [13] | JING Bo, CHEN Peng-hui, GAO Xiang, XU Yuan-yuan, WU Yun-zhao, SUN Yun, WU Ying-li . Establishment of cell-based screening system for compound regulating the stability of retinoic acid receptors [J]. , 2017, 37(4): 432-. |
| [14] | LIU Zu-yin, LI Qing, CHEN Li-jun, et al. Inhibition of adipogenic differentiation of bone marrow mesenchymal stem cells by all-trans retinoic acid through direct regulation of PPARγ2 by RARγ [J]. , 2015, 35(5): 682-. |
| [15] | CHEN Li-jun, REN Lan, LIU Zu-yin, et al. Effects of marginal vitamin A deficiency in pregnancy on expressions of retinoic acid receptor alpha, Src, and NMDAR1 of newborn rats [J]. , 2015, 35(4): 500-. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||