Hypericin alleviates podocyte injury in diabetic nephropathy by inhibiting the NF-κB signaling pathway

doi:10.3969/j.issn.1674-8115.2026.01.005

Abstract

Abstract:

Objective ·To investigate the protective effect of the natural compound hypericin (HYP) on podocyte injury in diabetic nephropathy (DN) and its underlying molecular mechanism. Methods ·A total of eighteen db/db mice were selected to establish the DN model and were randomly divided into three groups: the model group, the db/db + HYP low-dose group (db/db+HYP-L, 1.5 mg/kg), and the db/db+HYP high-dose group (db/db+HYP-H, 3 mg/kg). Additionally, six db/m mice were designated as the normal control group. The following parameters were measured in mice from each group: fasting blood glucose (FBG), insulin (INS), total cholesterol (TC), triglyceride (TAG), low-density lipoprotein (LDL), high-density lipoprotein (HDL), serum creatinine (Scr), blood urea nitrogen (BUN), urinary albumin-to-creatinine ratio (UACR), as well as levels of inflammatory cytokines, including tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL-6), and monocyte chemoattractant protein-1 (MCP-1). Renal pathological changes and podocyte ultrastructure in mice from each group were examined by hematoxylin-eosin (HE) staining, periodic acid-Schiff (PAS) staining, and transmission electron microscopy. The expression of the podocyte marker Wilms tumor 1 (WT-1) in renal tissues from each group was assessed using immunohistochemistry and Western blotting. The protein expression level of nuclear factor-κB (NF-κB) was also measured by Western blotting. Human podocyte lines were cultured in vitro to establish a high-glucose-induced podocyte injury model. The experiment was divided into five groups: normal glucose (5.5 mmol/L glucose, NG), mannitol (5.5 mmol/L glucose+24.5 mmol/L mannitol, MA), high glucose (30.0 mmol/L glucose, HG), high glucose+0.05 μg/mL HYP, and high glucose+0.20 μg/mL HYP. Cells were harvested after 48 h of incubation. The protein levels of WT-1, phospho-NF-κB p65 (p-NF-κB p65), and NF-κB p65 were determined by Western blotting. The mRNA expression levels of inflammatory cytokines (TNF-α, IL-1β, IL-6, and MCP-1) in human podocytes across all groups were measured by quantitative real-time PCR (qPCR). Results ·Compared with the model group, HYP administration significantly reduced the levels of FBG, INS, TC, TAG, LDL, Scr, BUN, and UACR in db/db mice, while significantly increasing the level of HDL (all P<0.05). Concomitantly, HYP alleviated podocyte injury in db/db mice, as evidenced by a marked reduction in foot process effacement and restoration of a comb-like alignment of the foot processes. Both in vivo and in vitro studies demonstrated that HYP upregulated the expression of WT-1 while concurrently suppressing the phosphorylation of NF-κB p65 and the subsequent release of NF-κB-mediated inflammatory cytokines (TNF-α, IL-1β, IL-6, and MCP-1) (all P<0.05). Conclusion ·HYP alleviates podocyte injury in db/db mice, an effect that may be attributed to the upregulation of WT-1 expression and inhibition of the NF-κB signaling pathway, leading to reduced expression of downstream inflammatory cytokines.

Key words: hypericin (HYP), diabetic nephropathy (DN), podocyte, nuclear factor-kappa B (NF-κB), inflammation

CLC Number:

R692.9

Han Zhen, Wang Hao, Su Xiuxiu, Fang Ji. Hypericin alleviates podocyte injury in diabetic nephropathy by inhibiting the NF-κB signaling pathway[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(1): 43-53.

Figures/Tables 9

Tab 1 Primer sequences for qPCR

Gene	Forward primer (5′→3′)	Reverse primer (5′→3′)
TNF-α	GGCAGGTTCTGTCCCTTTCA	CTGTGCTCATGGTGTCTTTTCTG
IL-1β	CTACAGGCTCCGAGATGAACAAC	TCCATTGAGGTGGAGAGCTTTC
IL-6	ACTCACCTCTTCAGAACGAATTG	CCATCTTTGGAAGGTTCAGGTTG
MCP-1	CAGCCAGATGCAATCAATGCC	TGGAATCCTGAACCCACTTCT
β-actin	CATGTACGTTGCTATCCAGGC	CTCCTTAATGTCACGCACGAT

Fig 1 Distribution of HYP in the kidneys of db/db mice and HPCs

Fig 2 Dynamic multi-parameter analysis of diabetic metabolic phenotypes in db/db mice

Fig 3 Effect of HYP intervention on glucose and lipid metabolism in db/db mice

Fig 4 Hypericin ameliorates renal dysfunction in db/db mice

Fig 5 Renal histopathological changes were evaluated by HE staining, PAS staining, immunohistochemistry, and transmission electron microscopy

Fig 6 Effects of HYP on the viability of high-glucose-induced HPCs

Fig 7 HYP downregulates the expression of inflammatory cytokines

Fig 8 Effect of HYP on WT-1 and NF-κB signaling pathway protein expression analyzed by Western blotting

TrendMD

References 27

[1]	Wang H, Liu D W, Zheng B, et al. Emerging role of ferroptosis in diabetic kidney disease: molecular mechanisms and therapeutic opportunities[J]. Int J Biol Sci, 2023, 19(9): 2678-2694.
[2]	Tuttle K R, Agarwal R, Alpers C E, et al. Molecular mechanisms and therapeutic targets for diabetic kidney disease[J]. Kidney Int, 2022, 102(2): 248-260.
[3]	Zuo F W, Liu Z Y, Wang M W, et al. CCDC92 promotes podocyte injury by regulating PA28α/ABCA1/cholesterol efflux axis in type 2 diabetic mice[J]. Acta Pharmacol Sin, 2024, 45(5): 1019-1031.
[4]	Qiu D J, Song S, Chen N, et al. NQO1 alleviates renal fibrosis by inhibiting the TLR4/NF-κB and TGF-β/Smad signaling pathways in diabetic nephropathy[J]. Cell Signal, 2023, 108: 110712.
[5]	Myakala K, Wang X X, Shults N V, et al. NAD metabolism modulates inflammation and mitochondria function in diabetic kidney disease[J]. J Biol Chem, 2023, 299(8): 104975.
[6]	Tang S C W, Yiu W H. Innate immunity in diabetic kidney disease[J]. Nat Rev Nephrol, 2020, 16(4): 206-222.
[7]	Sun L, Kanwar Y S. Relevance of TNF-α in the context of other inflammatory cytokines in the progression of diabetic nephropathy[J]. Kidney Int, 2015, 88(4): 662-665.
[8]	Lin Q X, Ma Y Q, Chen Z W, et al. Sestrin-2 regulates podocyte mitochondrial dysfunction and apoptosis under high-glucose conditions via AMPK[J]. Int J Mol Med, 2020, 45(5): 1361-1372.
[9]	Zhu L P, Han J K, Yuan R R, et al. Berberine ameliorates diabetic nephropathy by inhibiting TLR4/NF-κB pathway[J]. Biol Res, 2018, 51(1): 9.
[10]	Zhong Y F, Lee K, Deng Y Y, et al. Arctigenin attenuates diabetic kidney disease through the activation of PP2A in podocytes[J]. Nat Commun, 2019, 10(1): 4523.
[11]	Peng Z L, Lu J, Liu K, et al. Hypericin as a promising natural bioactive naphthodianthrone: a review of its pharmacology, pharmacokinetics, toxicity, and safety[J]. Phytother Res, 2023, 37(12): 5639-5656.
[12]	Zirak N, Shafiee M, Soltani G, et al. Hypericum perforatum in the treatment of psychiatric and neurodegenerative disorders: current evidence and potential mechanisms of action[J]. J Cell Physiol, 2019, 234(6): 8496-8508.
[13]	Cao K, Zhang Y, Yao Q, et al. Hypericin blocks the function of HSV-1 alkaline nuclease and suppresses viral replication[J]. J Ethnopharmacol, 2022, 296: 115524.
[14]	WoźNiak M, Nowak-Perlak M. Hypericin-based photodynamic therapy displays higher selectivity and phototoxicity towards melanoma and squamous cell cancer compared to normal keratinocytes in vitro[J]. Int J Mol Sci, 2023, 24(23): 16897.
[15]	Karioti A, Bilia A R. Hypericins as potential leads for new therapeutics[J]. Int J Mol Sci, 2010, 11(2): 562-594.
[16]	Dong Q, Hu N, Yue H L, et al. Inhibitory activity and mechanism investigation of hypericin as a novel α-glucosidase inhibitor[J]. Molecules, 2021, 26(15): 4566.
[17]	Chen S Z, Liu X X, Peng C, et al. The phytochemical hyperforin triggers thermogenesis in adipose tissue via a Dlat-AMPK signaling axis to curb obesity[J]. Cell Metab, 2021, 33(3): 565-580.e7.
[18]	Dellafiora L, Galaverna G, Cruciani G, et al. On the mechanism of action of anti-inflammatory activity of hypericin: an in silico study pointing to the relevance of Janus kinases inhibition[J]. Molecules, 2018, 23(12): 3058.
[19]	Novelli M, Masiello P, Beffy P, et al. Protective role of St. John′s wort and its components hyperforin and hypericin against diabetes through inhibition of inflammatory signaling: evidence from in vitro and in vivo studies[J]. Int J Mol Sci, 2020, 21(21): 8108.
[20]	Liang C, Li Y, Bai M, et al. Hypericin attenuates nonalcoholic fatty liver disease and abnormal lipid metabolism via the PKA-mediated AMPK signaling pathway in vitro and in vivo[J]. Pharmacol Res, 2020, 153: 104657.
[21]	Wu L, Liu C J, Chang D Y, et al. Annexin A1 alleviates kidney injury by promoting the resolution of inflammation in diabetic nephropathy[J]. Kidney Int, 2021, 100(1): 107-121.
[22]	Sun Z J, Chang D Y, Chen M, et al. Deficiency of CFB attenuates renal tubulointerstitial damage by inhibiting ceramide synthesis in diabetic kidney disease[J]. JCI Insight, 2022, 7(24): e156748.
[23]	Bork P M, Bacher S, Schmitz M L, et al. Hypericin as a non-antioxidant inhibitor of NF-kappa B[J]. Planta Med, 1999, 65(4): 297-300.
[24]	Chen H J, Muhammad I, Zhang Y, et al. Antiviral activity against infectious bronchitis virus and bioactive components of Hypericum perforatum L[J]. Front Pharmacol, 2019, 10: 1272.
[25]	Zhang K, Gao S, Guo J Y, et al. Hypericin-photodynamic therapy inhibits proliferation and induces apoptosis in human rheumatoid arthritis fibroblast-like synoviocytes cell line MH7A[J]. Iran J Basic Med Sci, 2018, 21(2): 130-137.
[26]	Novelli M, Beffy P, Gregorelli A, et al. Persistence of STAT-1 inhibition and induction of cytokine resistance in pancreatic β cells treated with St John′s wort and its component hyperforin[J]. J Pharm Pharmacol, 2019, 71(1): 93-103.
[27]	Zhai X J, Chen Y, Han X M, et al. The protective effect of hypericin on postpartum depression rat model by inhibiting the NLRP3 inflammasome activation and regulating glucocorticoid metabolism[J]. Int Immunopharmacol, 2022, 105: 108560.