Potential role of SUMO-specific proteases 1 in ferroptosis

doi:10.3969/j.issn.1674-8115.2025.01.002

Abstract

Abstract:

Objective ·To explore the potential role of SUMO-specific protease 1 (SENP1) in ferroptosis. Methods ·The Cancer Genome Atlas (TCGA) database was used to analyze the correlation between the expression levels of SENP1 and the ferroptosis-related genes, acyl-CoA synthetase long chain family member 4 (ACSL4) and glutathione peroxidase 4 (GPX4). Ferroptosis in human fibrosarcoma HT1080 cells, murine fibrosarcoma MCA-205 cells, and human embryonic kidney 293T cells was induced by RAS-selective lethal 3 (RSL3). Quantitative real-time PCR (RT-qPCR) and Western blotting were used to detect the expression of SENP1. In 293T cells, immunoprecipitation-mass spectrometry was used to investigate the interacting proteins of SENP1 in the process of ferroptosis. The Flag-SENP1 plasmid was transiently transfected into 293T cells, and the overexpression efficiency of SENP1, along with the expression levels of ferroptosis-related genes ACSL4 and GPX4,was assessed by RT-qPCR and Western blotting. Results ·TCGA database analysis showed that the expression of SENP1 was positively correlated with ACSL4 and negatively correlated with GPX4 in most tumor tissues. RT-qPCR and Western blotting showed that the expression level of SENP1 was significantly down-regulated in RSL3-treated HT1080, MCA-205, and 293T cells. Immunoprecipitation-mass spectrometry showed that SENP1 enriched SUMO molecules in the process of ferroptosis. Western blotting showed that the level of ACSL4 protein increased after SENP1 overexpression, and there was no significant change in the level of GPX4 protein. RT-qPCR showed that after SENP1 overexpression, there was no significant change in the mRNA levels of ACSL4 and GPX4. Conclusion ·SENP1 gene expression is downregulated during ferroptosis, and may regulate the stability of ferroptosis-related protein ACSL4.

Key words: ferroptosis, SUMO-specific protease 1 (SENP1), acyl-CoA synthetase long chain family member 4 (ACSL4), glutathione peroxidase 4 (GPX4), small ubiquitin-related modifier protein (SUMO)

CLC Number:

XIE Bin, BAI Meng, WU Yan, WO Lulu, HUANG Ying, ZHANG Jing. Potential role of SUMO-specific proteases 1 in ferroptosis[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(1): 11-19.

Figures/Tables 5

Tab 1 Primer sequences for RT-qPCR

Gene	Forward primer (5′→3′)	Reverse primer (5′→3′)
SENP1	CCAGATTGAAGAACAGAA	GACAACAGTAACAGGAAT
GAPDH	ACATCGCTCAGACACCATG	TGTAGTTGAGGTCAATGAAGGG
ACSL4	CATCCCTGGAGCAGATACTCT	TCACTTAGGATTTCCCTGGTCC
GPX4	GAGGCAAGACCGAAGTAAACTAC	CCGAACTGGTTACACGGGAA

Fig 1 Correlation analysis of SENP1 with ACSL4/GPX4 in the TCGA database

Fig 2 mRNA and protein expression levels of SENP1 during ferroptosis induction

Fig 3 Interacting proteins of SENP1 detected by IP-MS during ferroptosis

Fig 4 Expression of ferroptosis-related genes after overexpression of SENP1

TrendMD

References 23

1	DIXON S J, LEMBERG K M, LAMPRECHT M R, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death[J]. Cell, 2012, 149(5): 1060-1072.
2	LI X Y, MA N, XU J P, et al. Targeting ferroptosis: pathological mechanism and treatment of ischemia-reperfusion injury[J]. Oxid Med Cell Longev, 2021, 2021: 1587922.
3	LEI G, ZHUANG L, GAN B Y. Targeting ferroptosis as a vulnerability in cancer[J]. Nat Rev Cancer, 2022, 22(7): 381-396.
4	JIANG X J, STOCKWELL B R, CONRAD M. Ferroptosis: mechanisms, biology and role in disease[J]. Nat Rev Mol Cell Biol, 2021, 22(4): 266-282.
5	YANG W S, STOCKWELL B R. Synthetic lethal screening identifies compounds activating iron-dependent, nonapoptotic cell death in oncogenic-RAS-harboring cancer cells[J]. Chem Biol, 2008, 15(3): 234-245.
6	DOLL S, PRONETH B, TYURINA Y Y, et al. ACSL4 dictates ferroptosis sensitivity by shaping cellular lipid composition[J]. Nat Chem Biol, 2017, 13(1): 91-98.
7	YANG W S, SRIRAMARATNAM R, WELSCH M E, et al. Regulation of ferroptotic cancer cell death by GPX4[J]. Cell, 2014, 156(1/2): 317-331.
8	SHENG Z H, ZHU J, DENG Y N, et al. SUMOylation modification-mediated cell death[J]. Open Biol, 2021, 11(7): 210050.
9	LIU P F, WU D, DUAN J Y, et al. NRF2 regulates the sensitivity of human NSCLC cells to cystine deprivation-induced ferroptosis via FOCAD-FAK signaling pathway[J]. Redox Biol, 2020, 37: 101702.
10	GUO H Y, XU J Q, ZHENG Q, et al. NRF2 SUMOylation promotes de novo serine synthesis and maintains HCC tumorigenesis[J]. Cancer Lett, 2019, 466: 39-48.
11	ZHANG Z L, GUO M, SHEN M, et al. The BRD7-P53-SLC25A28 axis regulates ferroptosis in hepatic stellate cells[J]. Redox Biol, 2020, 36: 101619.
12	KANG R, ZHU S, ZEH H J, et al. BECN1 is a new driver of ferroptosis[J]. Autophagy, 2018, 14(12): 2173-2175.
13	WU J, MINIKES A M, GAO M H, et al. Intercellular interaction dictates cancer cell ferroptosis via NF2-YAP signalling[J]. Nature, 2019, 572(7769): 402-406.
14	WU Y C, LING T Y, LU S H, et al. Chemotherapeutic sensitivity of testicular germ cell tumors under hypoxic conditions is negatively regulated by SENP1-controlled sumoylation of OCT4[J]. Cancer Res, 2012, 72(19): 4963-4973.
15	CUI C P, WONG C C, KAI A K, et al. SENP1 promotes hypoxia-induced cancer stemness by HIF-1α deSUMOylation and SENP1/HIF-1α positive feedback loop[J]. Gut, 2017, 66(12): 2149-2159.
16	ADAMS B D, CLAFFEY K P, WHITE B A. Argonaute-2 expression is regulated by epidermal growth factor receptor and mitogen-activated protein kinase signaling and correlates with a transformed phenotype in breast cancer cells[J]. Endocrinology, 2009, 150(1): 14-23.
17	YAN L, ZHANG T, WANG K, et al. SENP1 prevents steatohepatitis by suppressing RIPK1-driven apoptosis and inflammation[J]. Nat Commun, 2022, 13(1): 7153.
18	YEH E T, GONG L, KAMITANI T. Ubiquitin-like proteins: new wines in new bottles[J]. Gene, 2000, 248(1/2): 1-14.
19	ZHOU H J, XU Z, WANG Z R, et al. Author Correction: SUMOylation of VEGFR2 regulates its intracellular trafficking and pathological angiogenesis[J]. Nat Commun, 2019, 10: 3679.
20	DOLL S, FREITAS F P, SHAH R, et al. FSP1 is a glutathione-independent ferroptosis suppressor[J]. Nature, 2019, 575(7784): 693-698.
21	MAO C, LIU X G, ZHANG Y L, et al. DHODH-mediated ferroptosis defence is a targetable vulnerability in cancer[J]. Nature, 2021, 593(7860): 586-590.
22	FENG H, SCHORPP K, JIN J, et al. Transferrin receptor is a specific ferroptosis marker[J]. Cell Rep, 2020, 30(10): 3411-3423.e7.
23	YUAN H, LI X, ZHANG X, et al. Identification of ACSL4 as a biomarker and contributor of ferroptosis[J]. Biochem Biophys Res Commun, 2016, 478(3): 1338-1343.

[1]	WANG Jingyi, DENG Jiali, ZHU Yi, DING Xinyi, GUO Jiajing, WANG Zhongling. Experimental study on novel pH-responsive manganese-based nanoprobes for ferroptosis and magnetic resonance imaging in breast cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(9): 1183-1193.
[2]	WAN Hongjin, HU Yibin, WANG Xin, ZHANG Kai, QIN An, MA Peixiang, MA Hui, ZHAO Jie. Neferine alleviates intervertebral disc degeneration through KEAP1/NRF2/GPX4 and NF-κB signaling pathways [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(3): 261-270.
[3]	LI Guanghui, FENG Xiaoling. Research progress on ferroptosis of placental cells in recurrent spontaneous abortion [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(10): 1383-1389.
[4]	CHEN Chen, CHENG Zhuoan, WANG Cun, XIA Qiang. Research progress in ferroptosis regulation in the treatment of liver diseases [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(3): 365-373.
[5]	DU Yuting, ZHANG Jing, HUANG Ying, ZHANG Jing. Effect of ferroptosis on regeneration after muscle injury [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(3): 298-306.
[6]	Qian WEI, Ying-ting ZHANG, Long-shuai LIN, En-jun HE, Yong-yuan HE, Ying-hong SU, Cheng-cheng DUAN, Si-yuan WANG, Qing-hua ZHAO, Qian ZHAO, Ming HE. Haptoglobin suppresses hepatocyte ferroptosis via inhibition of the ERK1/2 signaling pathway [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 999-1008.
[7]	HE Ming, WEI Qian, ZHANG Ying-ting. Research progress in the mechanism of ferroptosis and its role in liver related diseases [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(11): 1519-1523.