
Journal of Shanghai Jiao Tong University (Medical Science) ›› 2025, Vol. 45 ›› Issue (11): 1515-1526.doi: 10.3969/j.issn.1674-8115.2025.11.011
• Techniques and methods • Previous Articles Next Articles
ZHU Yue1,2,3, LI Xiaoqin1,2,3, WANG Wenxiao1,2,3, ZHOU Lingyun1,2,3, WU Hao1,2,3, TAO Yong1,2,3(
), DU Tingting1,2,3(
)
Received:2025-02-13
Accepted:2025-04-25
Online:2025-11-28
Published:2025-12-03
Contact:
TAO Yong, DU Tingting
E-mail:taoyent@sjtu.edu.cn;tingtingdu@shsmu.edu.cn
Supported by:CLC Number:
ZHU Yue, LI Xiaoqin, WANG Wenxiao, ZHOU Lingyun, WU Hao, TAO Yong, DU Tingting. An efficient isolation method for pericytes of the cochlear stria vascularis[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(11): 1515-1526.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2025.11.011
| Gene | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| Gapdh | AGCTTCGGCACATATTTCATCTG | CGTTCACTCCCATGACAAACA |
| Pdgfrb | ACCTGCAGAGACCTCAAAAGTAGGT | ACCACGGTGACCTCCTGCGA |
| Desm | AGCCAGCGCGTGTCCTCCTA | AGCGTCGGCCAGGGAGAAGT |
| Vwf | TGTTCATCAAATGGTGGGCAGC | ACAGACGCCATCTCCAGATTCA |
| Glut1 | GCTGTGCTTATGGGCTTCTC | AGAGGCCACAAGTCTGCATT |
| Gsta4 | GCTGCGGCTGGAGTGGAGTTTG | TGCCCAACTGAGCTGGTTGCC |
| Adgre1 | TGCATCTAGCAATGGACAGC | GCCTTCTGGATCCATTTGAA |
Tab 1 Primer sequences used for RT-qPCR
| Gene | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| Gapdh | AGCTTCGGCACATATTTCATCTG | CGTTCACTCCCATGACAAACA |
| Pdgfrb | ACCTGCAGAGACCTCAAAAGTAGGT | ACCACGGTGACCTCCTGCGA |
| Desm | AGCCAGCGCGTGTCCTCCTA | AGCGTCGGCCAGGGAGAAGT |
| Vwf | TGTTCATCAAATGGTGGGCAGC | ACAGACGCCATCTCCAGATTCA |
| Glut1 | GCTGTGCTTATGGGCTTCTC | AGAGGCCACAAGTCTGCATT |
| Gsta4 | GCTGCGGCTGGAGTGGAGTTTG | TGCCCAACTGAGCTGGTTGCC |
| Adgre1 | TGCATCTAGCAATGGACAGC | GCCTTCTGGATCCATTTGAA |
| Enzyme type | Total number of granules/n | Proportion of cells/% | Proportion of single cells/% | Proportion of living cells/% | Digestion condition | |
|---|---|---|---|---|---|---|
| Enzyme concentration/(U·mL-1) | Mechanical dissociation time/min | |||||
| Papain | 21 701 | 50.5 | 99.0 | 73.0 | 20 | 2 |
| 25 809 | 43.1 | 98.5 | 71.3 | 20 | 1 | |
| 37 429 | 53.5 | 94.5 | 78.6 | 10 | 1 | |
Tab 2 Digestion efficiency of papain under different conditions
| Enzyme type | Total number of granules/n | Proportion of cells/% | Proportion of single cells/% | Proportion of living cells/% | Digestion condition | |
|---|---|---|---|---|---|---|
| Enzyme concentration/(U·mL-1) | Mechanical dissociation time/min | |||||
| Papain | 21 701 | 50.5 | 99.0 | 73.0 | 20 | 2 |
| 25 809 | 43.1 | 98.5 | 71.3 | 20 | 1 | |
| 37 429 | 53.5 | 94.5 | 78.6 | 10 | 1 | |
| Enzyme type | Total number of granules/n | Proportion of cells/% | Proportion of single cells/% | Proportion of living cells/% | Digestion condition | |
|---|---|---|---|---|---|---|
| Enzyme concentration/(mg·mL-1) | Mechanical dissociation time/min | |||||
| CAP | 26 696 | 31.6 | 94.5 | 58.3 | 10 | 2 |
| 22 715 | 42.8 | 96.5 | 69.1 | 5 | 2 | |
| 32 321 | 57.5 | 95.4 | 76.0 | 5 | 1 | |
Tab 3 Digestion efficiency of CAP under different conditions
| Enzyme type | Total number of granules/n | Proportion of cells/% | Proportion of single cells/% | Proportion of living cells/% | Digestion condition | |
|---|---|---|---|---|---|---|
| Enzyme concentration/(mg·mL-1) | Mechanical dissociation time/min | |||||
| CAP | 26 696 | 31.6 | 94.5 | 58.3 | 10 | 2 |
| 22 715 | 42.8 | 96.5 | 69.1 | 5 | 2 | |
| 32 321 | 57.5 | 95.4 | 76.0 | 5 | 1 | |
| Enzyme type | Total number of granules/n | Proportion of cells/% | Proportion of single cells/% | Proportion of living cells/% |
|---|---|---|---|---|
| Thermolysin and Accutase | 131 421 | 58.4 | 87.7 | 81.0 |
| 194 163 | 60.8 | 79.9 | 79.2 | |
| 105 934 | 64.4 | 98.5 | 25.4 |
Tab 4 Digestion efficiency of thermolysin and Accutase in three replicates under the same condition
| Enzyme type | Total number of granules/n | Proportion of cells/% | Proportion of single cells/% | Proportion of living cells/% |
|---|---|---|---|---|
| Thermolysin and Accutase | 131 421 | 58.4 | 87.7 | 81.0 |
| 194 163 | 60.8 | 79.9 | 79.2 | |
| 105 934 | 64.4 | 98.5 | 25.4 |
| Enzyme type | Total number of granules/n | Proportion of cells/% | Proportion of single cells/% | Proportion of living cells/% | Digestion condition | ||
|---|---|---|---|---|---|---|---|
| Digestion time/min | Mechanical dissociation time/min | Repeated time/n | |||||
| Accutase | 34 791 | 48.1 | 93.9 | 53.0 | 3 | 1 | 3 |
| 48 120 | 67.9 | 94.0 | 73.9 | 5 | 1 | 4 | |
| 65 398 | 60.5 | 94.9 | 76.0 | 5 | 2 | 3 | |
Tab 5 Digestion efficiency of Accutase under different conditions
| Enzyme type | Total number of granules/n | Proportion of cells/% | Proportion of single cells/% | Proportion of living cells/% | Digestion condition | ||
|---|---|---|---|---|---|---|---|
| Digestion time/min | Mechanical dissociation time/min | Repeated time/n | |||||
| Accutase | 34 791 | 48.1 | 93.9 | 53.0 | 3 | 1 | 3 |
| 48 120 | 67.9 | 94.0 | 73.9 | 5 | 1 | 4 | |
| 65 398 | 60.5 | 94.9 | 76.0 | 5 | 2 | 3 | |
| [1] | LI M M, ABOU TAYOUN A, DISTEFANO M, et al. Clinical evaluation and etiologic diagnosis of hearing loss: a clinical practice resource of the American College of Medical Genetics and Genomics (ACMG)[J]. Genet Med, 2022, 24(7): 1392-1406. |
| [2] | YU W T, ZONG S M, DU P Y, et al. Role of the stria vascularis in the pathogenesis of sensorineural hearing loss: a narrative review[J]. Front Neurosci, 2021, 15: 774585. |
| [3] | LANG H N, NOBLE K V, BARTH J L, et al. The stria vascularis in mice and humans is an early site of age-related cochlear degeneration, macrophage dysfunction, and inflammation[J]. J Neurosci, 2023, 43(27): 5057-5075. |
| [4] | HIBINO H, NIN F, TSUZUKI C, et al. How is the highly positive endocochlear potential formed? The specific architecture of the stria vascularis and the roles of the ion-transport apparatus[J]. Pflugers Arch, 2010, 459(4): 521-533. |
| [5] | ZHANG Y P, NENG L L, SHARMA K, et al. Pericytes control vascular stability and auditory spiral ganglion neuron survival[J]. eLife, 2023, 12: e83486. |
| [6] | SHI X R. Pathophysiology of the cochlear intrastrial fluid-blood barrier (review)[J]. Hear Res, 2016, 338: 52-63. |
| [7] | ARMULIK A, GENOVÉ G, BETSHOLTZ C. Pericytes: developmental, physiological, and pathological perspectives, problems, and promises[J]. Dev Cell, 2011, 21(2): 193-215. |
| [8] | SHI X R. Cochlear pericyte responses to acoustic trauma and the involvement of hypoxia-inducible factor-1α and vascular endothelial growth factor[J]. Am J Pathol, 2009, 174(5): 1692-1704. |
| [9] | SHI T F, ZHOU Z, JIANG W J, et al. Hyperglycemia-induced oxidative stress exacerbates mitochondrial apoptosis damage to cochlear stria vascularis pericytes via the ROS-mediated Bcl-2/CytC/AIF pathway[J]. Redox Rep, 2024, 29(1): 2382943. |
| [10] | GU J Y, TONG L, LIN X, et al. The disruption and hyperpermeability of blood-labyrinth barrier mediates cisplatin-induced ototoxicity[J]. Toxicol Lett, 2022, 354: 56-64. |
| [11] | NENG L L, ZHANG W J, HASSAN A, et al. Isolation and culture of endothelial cells, pericytes and perivascular resident macrophage-like melanocytes from the young mouse ear[J]. Nat Protoc, 2013, 8(4): 709-720. |
| [12] | KORRAPATI S, TAUKULIS I, OLSZEWSKI R, et al. Single cell and single nucleus RNA-seq reveal cellular heterogeneity and homeostatic regulatory networks in adult mouse stria vascularis[J]. Front Mol Neurosci, 2019, 12: 316. |
| [13] | THULASIRAM M R, OGIER J M, DABDOUB A. Hearing function, degeneration, and disease: spotlight on the stria vascularis[J]. Front Cell Dev Biol, 2022, 10: 841708. |
| [14] | GU S J, OLSZEWSKI R, TAUKULIS I, et al. Characterization of rare spindle and root cell transcriptional profiles in the stria vascularis of the adult mouse cochlea[J]. Sci Rep, 2020, 10(1): 18100. |
| [15] | ZHOU L Y, JIN C X, WANG W X, et al. Differential regulation of hair cell actin cytoskeleton mediated by SRF and MRTFB[J]. eLife, 2023, 12: e90155. |
| [16] | HERTZANO R, GWILLIAM K, ROSE K, et al. Cell type-specific expression analysis of the inner ear: a technical report[J]. Laryngoscope, 2021, 131(Suppl 5): S1-S16. |
| [17] | JEAN P, WONG JUN TAI F, SINGH-ESTIVALET A, et al. Single-cell transcriptomic profiling of the mouse cochlea: an atlas for targeted therapies[J]. Proc Natl Acad Sci USA, 2023, 120(26): e2221744120. |
| [18] | DA SILVA MEIRELLES L, MALTA T M, DE DEUS WAGATSUMA V M, et al. Cultured human adipose tissue pericytes and mesenchymal stromal cells display a very similar gene expression profile[J]. Stem Cells Dev, 2015, 24(23): 2822-2840. |
| [19] | HOU Z Q, WANG X H, CAI J, et al. Platelet-derived growth factor subunit B signaling promotes pericyte migration in response to loud sound in the cochlear stria vascularis[J]. J Assoc Res Otolaryngol, 2018, 19(4): 363-379. |
| [20] | SHI X, HAN W, YAMAMOTO H, et al. The cochlear pericytes[J]. Microcirculation, 2008, 15(6): 515-529. |
| [21] | SHI X R. Resident macrophages in the cochlear blood-labyrinth barrier and their renewal via migration of bone-marrow-derived cells[J]. Cell Tissue Res, 2010, 342(1): 21-30. |
| [22] | BURNS J C, KELLY M C, HOA M, et al. Single-cell RNA-Seq resolves cellular complexity in sensory organs from the neonatal inner ear[J]. Nat Commun, 2015, 6: 8557. |
| [23] | JAN T A, ELTAWIL Y, LING A H, et al. Spatiotemporal dynamics of inner ear sensory and non-sensory cells revealed by single-cell transcriptomics[J]. Cell Rep, 2021, 36(2): 109358. |
| [24] | ROBERTSON R T, LEVINE S T, HAYNES S M, et al. Use of labeled tomato lectin for imaging vasculature structures[J]. Histochem Cell Biol, 2015, 143(2): 225-234. |
| [25] | HOU Z Q, NENG L L, ZHANG J H, et al. Acoustic trauma causes cochlear pericyte-to-myofibroblast-like cell transformation and vascular degeneration, and transplantation of new pericytes prevents vascular atrophy[J]. Am J Pathol, 2020, 190(9): 1943-1959. |
| [26] | SHIN S A, LYU A R, JEONG S H, et al. Acoustic trauma modulates cochlear blood flow and vasoactive factors in a rodent model of noise-induced hearing loss[J]. Int J Mol Sci, 2019, 20(21): 5316. |
| [27] | ANFUSO C D, COSENTINO A, AGAFONOVA A, et al. Pericytes of stria vascularis are targets of cisplatin-induced ototoxicity: new insights into the molecular mechanisms involved in blood-labyrinth barrier breakdown[J]. Int J Mol Sci, 2022, 23(24): 15790. |
| [28] | DUFEK B, MEEHAN D T, DELIMONT D, et al. Pericyte abnormalities precede strial capillary basement membrane thickening in Alport mice[J]. Hear Res, 2020, 390: 107935. |
| [1] | CHENG Yaqiong, DU Yiwei, LIU Sidi, JING Dian, WU Hao. Three-dimensional imaging of cochlear nerve fibers based on multi-scale resolution [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(11): 1421-1431. |
| [2] | ZHOU Weijun, LIU Sidi, CAI Ruijie, LIU Hongchao, WANG Meijian, WU Hao, LIU Huihui, WANG Zhaoyan. Role of astrocytes in the repair of auditory synapses in the cochlear nucleus after noise damage [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 454-461. |
| [3] | YANG Lu, HUANG Meiping, ZHOU Qian, LI Jin, LI Yun, HUANG Zhiwu. Study on long-term performance evaluation of auditory and speech ability in cochlear implant in congenital deaf children with cochlear nerve deficiency after cochlear implantation [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(7): 890-897. |
| [4] | GU Wenxi, JIA Huan, WU Hao. Clinical values and advances in computed tomography evaluation after cochlear implantation [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(12): 1463-1469. |
| [5] | XU Jingxuan, DU Shaoqian, CAO Yuan, WANG Hongxia, HUANG Weiyi. MMP14 expression in pancreatic cancer and its correlation with characteristics of tumor immune microenvironment [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(3): 312-322. |
| [6] | Jialei ZHOU, Haibin SHENG, Haoyu WANG, Yan LU, Fangfang WANG, Hao WU, Yunfeng HUA. Application of three-dimensional electron microscopy to morphological study of neurons in brainstem cochlear nucleus [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(2): 142-149. |
| [7] | XU Kang-li1, MA Ya-ni2, WANG Xiao-jin3, MIAO Yan-yan1, HAN Da1#, TAN Wei-hong1#. Using aptamer of sgc8 for diagnosis of acute leukemia [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(9): 1157-1167. |
| [8] | WANG Yun-han1, CHI Ya-nan1, YANG Guan-heng2, FAN Shu-yue1, MA Ji1, XUE Yan1, 2, ZENG Fan-yi1, 2. Biological characteristics and gene profile analysis of two kinds of mofetal liver stromal cells [J]. , 2019, 39(11): 1226-. |
| [9] | ZHANG Xiao-cui, FU Rong, ZHAO Ben-peng. Condition optimization of the flow cytometry MoFlo Astrios EQ on single-cell sorting in 96-well plate [J]. , 2018, 38(7): 845-. |
| [10] | TIAN Ye, LIU Ao, DONG Rui, QI Xing, YI Jing, YANG Jie. Flow cytometry detection of cellular redox status with genetically encoded fluorescent probe [J]. , 2018, 38(1): 10-. |
| [11] | LUAN Xiao-rui, LI Wei-ping . Relationship between subtypes of T follicular helper cells and unexplained recurrent spontaneous abortion [J]. , 2017, 37(10): 1346-. |
| [12] | FU Rong, ZHAO Ben-peng, YANG Jie, et al. Feasibility on treating indigestible cell lines by trypsin-EDTA solution for detection of cell apoptosis [J]. , 2015, 35(9): 1422-. |
| [13] | HUANG Hong-bo, XIE Ting-hong, SU Ming-hang, et al. Effects of video-assisted thoracoscopic surgery and conventional open thoracotomy on level of circulating tumor cells of patients with non-small-cell lung cancer during perioperative period [J]. , 2014, 34(8): 1171-. |
| [14] | RUAN Li-li, DU Jun-jun, LIN Yan, et al. Significance of CD64 index for early diagnosis of neonatal sepsis [J]. , 2014, 34(10): 1503-. |
| [15] | WANG Li, LIU Jia-ying, XIA Min, et al. Clinical research on Th1 and Th2 cytokines in children with acute leukemia [J]. , 2011, 31(11): 1657-. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||