An efficient isolation method for pericytes of the cochlear stria vascularis

doi:10.3969/j.issn.1674-8115.2025.11.011

Abstract

Abstract:

Objective ·To develop a stable and efficient method for isolating and obtaining pericytes from the cochlear stria vascularis while preserving their original physicochemical properties as much as possible. Methods ·Stria vascularis tissues were dissected from 6-day-old wild-type C57BL/6J mice under a microscope. Experimental conditions such as enzyme type, digestion time, and mechanical dissociation duration were optimized by evaluating single-cell yield and viability via flow cytometry (FCM). The single-cell samples were incubated with CD140b (i.e., platelet-derived growth factor receptor-β, PDGFR-β) and CD31 antibodies, and CD140b⁺CD31^- and CD140b^- cells were obtained by fluorescence-activated cell sorting (FACS). Reverse transcription quantitative polymerase chain reaction (RT-qPCR) was performed to assess the expression of pericyte markers [Pdgfrb and desmin (Desm)], endothelial cell markers [von Willebrand factor (Vwf)and glucose transporter 1 (Glut1)], and melanin-like macrophage markers [glutathione S-transferase α4 (Gsta4) and adhesion G protein-coupled receptor E1 (Adgre1)] to validate cell identity and the effectiveness of the isolation method. Results ·Flow cytometric analysis revealed that papain digestion of stria vascularis tissue caused significant cell damage and a high debris rate, cold-active protease showed low dissociation efficiency, and thermolysin combined with Accutase yielded unstable digestion efficiency and a relatively high debris rate. In contrast, Accutase alone consistently produced single-cell suspensions with relatively high yield and viability, and was therefore selected as the optimal enzyme. High-purity pericytes were successfully obtained by digesting stria vascularis tissue from 6-day-old mice with Accutase followed by sorting with CD140b and CD31 antibodies. RT-qPCR showed that CD140b⁺CD31^- cells specifically exhibited high expression levels of pericyte markers Pdgfrb and Desm, and low expression levels of endothelial cell markers Vwf and Glut1, as well as melanin-like macrophage markers Gsta4 and Adgre1. Conclusion ·A stable and effective flow cytometry-based method for isolating pericytes from the stria vascularis is successfully established.

Key words: cochlea, stria vascularis, pericyte, cell isolation, flow cytometry

CLC Number:

R764.3

ZHU Yue, LI Xiaoqin, WANG Wenxiao, ZHOU Lingyun, WU Hao, TAO Yong, DU Tingting. An efficient isolation method for pericytes of the cochlear stria vascularis[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(11): 1515-1526.

Figures/Tables 12

TrendMD

References 28

[1]	LI M M, ABOU TAYOUN A, DISTEFANO M, et al. Clinical evaluation and etiologic diagnosis of hearing loss: a clinical practice resource of the American College of Medical Genetics and Genomics (ACMG)[J]. Genet Med, 2022, 24(7): 1392-1406.
[2]	YU W T, ZONG S M, DU P Y, et al. Role of the stria vascularis in the pathogenesis of sensorineural hearing loss: a narrative review[J]. Front Neurosci, 2021, 15: 774585.
[3]	LANG H N, NOBLE K V, BARTH J L, et al. The stria vascularis in mice and humans is an early site of age-related cochlear degeneration, macrophage dysfunction, and inflammation[J]. J Neurosci, 2023, 43(27): 5057-5075.
[4]	HIBINO H, NIN F, TSUZUKI C, et al. How is the highly positive endocochlear potential formed? The specific architecture of the stria vascularis and the roles of the ion-transport apparatus[J]. Pflugers Arch, 2010, 459(4): 521-533.
[5]	ZHANG Y P, NENG L L, SHARMA K, et al. Pericytes control vascular stability and auditory spiral ganglion neuron survival[J]. eLife, 2023, 12: e83486.
[6]	SHI X R. Pathophysiology of the cochlear intrastrial fluid-blood barrier (review)[J]. Hear Res, 2016, 338: 52-63.
[7]	ARMULIK A, GENOVÉ G, BETSHOLTZ C. Pericytes: developmental, physiological, and pathological perspectives, problems, and promises[J]. Dev Cell, 2011, 21(2): 193-215.
[8]	SHI X R. Cochlear pericyte responses to acoustic trauma and the involvement of hypoxia-inducible factor-1α and vascular endothelial growth factor[J]. Am J Pathol, 2009, 174(5): 1692-1704.
[9]	SHI T F, ZHOU Z, JIANG W J, et al. Hyperglycemia-induced oxidative stress exacerbates mitochondrial apoptosis damage to cochlear stria vascularis pericytes via the ROS-mediated Bcl-2/CytC/AIF pathway[J]. Redox Rep, 2024, 29(1): 2382943.
[10]	GU J Y, TONG L, LIN X, et al. The disruption and hyperpermeability of blood-labyrinth barrier mediates cisplatin-induced ototoxicity[J]. Toxicol Lett, 2022, 354: 56-64.
[11]	NENG L L, ZHANG W J, HASSAN A, et al. Isolation and culture of endothelial cells, pericytes and perivascular resident macrophage-like melanocytes from the young mouse ear[J]. Nat Protoc, 2013, 8(4): 709-720.
[12]	KORRAPATI S, TAUKULIS I, OLSZEWSKI R, et al. Single cell and single nucleus RNA-seq reveal cellular heterogeneity and homeostatic regulatory networks in adult mouse stria vascularis[J]. Front Mol Neurosci, 2019, 12: 316.
[13]	THULASIRAM M R, OGIER J M, DABDOUB A. Hearing function, degeneration, and disease: spotlight on the stria vascularis[J]. Front Cell Dev Biol, 2022, 10: 841708.
[14]	GU S J, OLSZEWSKI R, TAUKULIS I, et al. Characterization of rare spindle and root cell transcriptional profiles in the stria vascularis of the adult mouse cochlea[J]. Sci Rep, 2020, 10(1): 18100.
[15]	ZHOU L Y, JIN C X, WANG W X, et al. Differential regulation of hair cell actin cytoskeleton mediated by SRF and MRTFB[J]. eLife, 2023, 12: e90155.
[16]	HERTZANO R, GWILLIAM K, ROSE K, et al. Cell type-specific expression analysis of the inner ear: a technical report[J]. Laryngoscope, 2021, 131(Suppl 5): S1-S16.
[17]	JEAN P, WONG JUN TAI F, SINGH-ESTIVALET A, et al. Single-cell transcriptomic profiling of the mouse cochlea: an atlas for targeted therapies[J]. Proc Natl Acad Sci USA, 2023, 120(26): e2221744120.
[18]	DA SILVA MEIRELLES L, MALTA T M, DE DEUS WAGATSUMA V M, et al. Cultured human adipose tissue pericytes and mesenchymal stromal cells display a very similar gene expression profile[J]. Stem Cells Dev, 2015, 24(23): 2822-2840.
[19]	HOU Z Q, WANG X H, CAI J, et al. Platelet-derived growth factor subunit B signaling promotes pericyte migration in response to loud sound in the cochlear stria vascularis[J]. J Assoc Res Otolaryngol, 2018, 19(4): 363-379.
[20]	SHI X, HAN W, YAMAMOTO H, et al. The cochlear pericytes[J]. Microcirculation, 2008, 15(6): 515-529.
[21]	SHI X R. Resident macrophages in the cochlear blood-labyrinth barrier and their renewal via migration of bone-marrow-derived cells[J]. Cell Tissue Res, 2010, 342(1): 21-30.
[22]	BURNS J C, KELLY M C, HOA M, et al. Single-cell RNA-Seq resolves cellular complexity in sensory organs from the neonatal inner ear[J]. Nat Commun, 2015, 6: 8557.
[23]	JAN T A, ELTAWIL Y, LING A H, et al. Spatiotemporal dynamics of inner ear sensory and non-sensory cells revealed by single-cell transcriptomics[J]. Cell Rep, 2021, 36(2): 109358.
[24]	ROBERTSON R T, LEVINE S T, HAYNES S M, et al. Use of labeled tomato lectin for imaging vasculature structures[J]. Histochem Cell Biol, 2015, 143(2): 225-234.
[25]	HOU Z Q, NENG L L, ZHANG J H, et al. Acoustic trauma causes cochlear pericyte-to-myofibroblast-like cell transformation and vascular degeneration, and transplantation of new pericytes prevents vascular atrophy[J]. Am J Pathol, 2020, 190(9): 1943-1959.
[26]	SHIN S A, LYU A R, JEONG S H, et al. Acoustic trauma modulates cochlear blood flow and vasoactive factors in a rodent model of noise-induced hearing loss[J]. Int J Mol Sci, 2019, 20(21): 5316.
[27]	ANFUSO C D, COSENTINO A, AGAFONOVA A, et al. Pericytes of stria vascularis are targets of cisplatin-induced ototoxicity: new insights into the molecular mechanisms involved in blood-labyrinth barrier breakdown[J]. Int J Mol Sci, 2022, 23(24): 15790.
[28]	DUFEK B, MEEHAN D T, DELIMONT D, et al. Pericyte abnormalities precede strial capillary basement membrane thickening in Alport mice[J]. Hear Res, 2020, 390: 107935.

Gene	Forward (5′→3′)	Reverse (5′→3′)
Gapdh	AGCTTCGGCACATATTTCATCTG	CGTTCACTCCCATGACAAACA
Pdgfrb	ACCTGCAGAGACCTCAAAAGTAGGT	ACCACGGTGACCTCCTGCGA
Desm	AGCCAGCGCGTGTCCTCCTA	AGCGTCGGCCAGGGAGAAGT
Vwf	TGTTCATCAAATGGTGGGCAGC	ACAGACGCCATCTCCAGATTCA
Glut1	GCTGTGCTTATGGGCTTCTC	AGAGGCCACAAGTCTGCATT
Gsta4	GCTGCGGCTGGAGTGGAGTTTG	TGCCCAACTGAGCTGGTTGCC
Adgre1	TGCATCTAGCAATGGACAGC	GCCTTCTGGATCCATTTGAA

Gene	Forward (5′→3′)	Reverse (5′→3′)
Gapdh	AGCTTCGGCACATATTTCATCTG	CGTTCACTCCCATGACAAACA
Pdgfrb	ACCTGCAGAGACCTCAAAAGTAGGT	ACCACGGTGACCTCCTGCGA
Desm	AGCCAGCGCGTGTCCTCCTA	AGCGTCGGCCAGGGAGAAGT
Vwf	TGTTCATCAAATGGTGGGCAGC	ACAGACGCCATCTCCAGATTCA
Glut1	GCTGTGCTTATGGGCTTCTC	AGAGGCCACAAGTCTGCATT
Gsta4	GCTGCGGCTGGAGTGGAGTTTG	TGCCCAACTGAGCTGGTTGCC
Adgre1	TGCATCTAGCAATGGACAGC	GCCTTCTGGATCCATTTGAA

Enzyme type	Total number of granules/n	Proportion of cells/%	Proportion of single cells/%	Proportion of living cells/%	Digestion condition
Enzyme type	Total number of granules/n	Proportion of cells/%	Proportion of single cells/%	Proportion of living cells/%	Enzyme concentration/(U·mL^－1)	Mechanical dissociation time/min
Papain	21 701	50.5	99.0	73.0	20	2
	25 809	43.1	98.5	71.3	20	1
	37 429	53.5	94.5	78.6	10	1

Enzyme type	Total number of granules/n	Proportion of cells/%	Proportion of single cells/%	Proportion of living cells/%	Digestion condition
Enzyme type	Total number of granules/n	Proportion of cells/%	Proportion of single cells/%	Proportion of living cells/%	Enzyme concentration/(U·mL^－1)	Mechanical dissociation time/min
Papain	21 701	50.5	99.0	73.0	20	2
	25 809	43.1	98.5	71.3	20	1
	37 429	53.5	94.5	78.6	10	1

Enzyme type	Total number of granules/n	Proportion of cells/%	Proportion of single cells/%	Proportion of living cells/%	Digestion condition
Enzyme type	Total number of granules/n	Proportion of cells/%	Proportion of single cells/%	Proportion of living cells/%	Enzyme concentration/(mg·mL^－1)	Mechanical dissociation time/min
CAP	26 696	31.6	94.5	58.3	10	2
	22 715	42.8	96.5	69.1	5	2
	32 321	57.5	95.4	76.0	5	1