Role and mechanism of fibroblast mitochondrial dysfunction in pulmonary arterial hypertension

doi:10.3969/j.issn.1674-8115.2026.03.003

Abstract

Abstract:

Objective ·To preliminarily investigate the role and mechanism of fibroblast mitochondrial dysfunction and its phenotypic transition in pulmonary arterial hypertension (PAH). Methods ·A PAH model was established in rats by using monocrotaline (MCT). Rat pulmonary arterial adventitial fibroblasts (RPAAFs) were isolated and stimulated with transforming growth factor β1 (TGF-β1) to induce fibroblast-to-myofibroblast transition (FMT). Interventions were performed using the peroxisome proliferator-activated receptor γ coactivator 1-α (Pgc1α) agonist ZLN005 and the mitochondrial uncoupler Fccp. Hemodynamic parameters were measured via right heart catheterization. Vascular remodeling was assessed by using hematoxylin-eosin staining and immunofluorescence staining. Mitochondrial morphology and function were observed by using transmission electron microscopy and live-cell staining (Mitotracker, TMRM, and MitoSOX). The expression levels of Pgc1α, vimentin, and smooth muscle actin α (α-SMA) were detected by Western blotting. The mRNA expression levels of Col1a1 and Col3a1 were measured by qPCR. Results ·Four weeks after MCT injection, mitochondria in rat pulmonary arterial adventitial fibroblasts became fragmented with a reduced mean area (P<0.001), and the protein expression level of Pgc1α decreased (P=0.016), promoting the transition of fibroblasts into myofibroblasts. After stimulation with TGF-β1, RPAAFs showed reduced mitochondrial number (P<0.001), decreased membrane potential (P=0.006), increased reactive oxygen species (P<0.001), decreased Pgc1α expression (P=0.006), significantly increased α-SMA protein expression, and increased Col1a1 and Col3a1 mRNA expression (all P<0.001). Fccp treatment similarly reduced mitochondrial membrane potential (P=0.005) and increased α-SMA, Col1a1, and Col3a1 expression (all P<0.001). Pretreatment with ZLN005 upregulated Pgc1α expression (P<0.001), improved TGF-β1-induced mitochondrial dysfunction, and suppressed α-SMA expression (P<0.001) in fibroblasts. In vivo, ZLN005 attenuated pulmonary artery remodeling, reduced perivascular collagen deposition, lowered right ventricular systolic pressure and mean pulmonary arterial pressure (both P<0.001), upregulated tissue Pgc1α expression, and inhibited α-SMA expression (P=0.007). Conclusion ·Fibroblast mitochondrial dysfunction promotes FMT and plays an important role in the pathophysiology of PAH.

Key words: pulmonary arterial hypertension, fibroblasts, mitochondrial dysfunction, Pgc1α

CLC Number:

R543.2

Chen Jiayu, Zhang Huili. Role and mechanism of fibroblast mitochondrial dysfunction in pulmonary arterial hypertension[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(3): 291-300.

Figures/Tables 6

Tab 1 Primer sequences for PCR

Primer name	Sequences (5′→3′)
α-tubulin
Forward	CTGATGTATGCCAAGCGTGC
Reverse	ATCCTTCTCTAGGGCAGCCA
Col1a1
Forward	CCAGCCGCAAAGAGTCTACAT
Reverse	ATGTCTTCTTGGCCATGCGT
Col3a1
Forward	GCCTACATGGATCAGGCCAA
Reverse	CATGGCCTTGCGTGTTTGAT

Fig 1 Establishment of the PAH model and FMT in fibroblasts

Fig 2 Mitochondrial dysfunction in fibroblasts in the PAH model

Fig 3 Fccp-induced mitochondrial dysfunction and FMT

Fig 4 ZLN005-mediated improvement in mitochondrial function and suppression of FMT

Fig 5 Amelioration of PAH in rats induced by ZLN005

TrendMD

References 35

[1]	Mocumbi A, Humbert M, Saxena A, et al. Pulmonary hypertension[J]. Nat Rev Dis Primers, 2024, 10: 1.
[2]	Strange G, Playford D, Stewart S, et al. Pulmonary hypertension: prevalence and mortality in the Armadale echocardiography cohort[J]. Heart, 2012, 98(24): 1805-1811.
[3]	Hassoun P M. Pulmonary arterial hypertension[J]. N Engl J Med, 2021, 385(25): 2361-2376.
[4]	Guignabert C, Aman J, Bonnet S, et al. Pathology and pathobiology of pulmonary hypertension: current insights and future directions[J]. Eur Respir J, 2024, 64(4): 2401095.
[5]	Thenappan T, Ormiston M L, Ryan J J, et al. Pulmonary arterial hypertension: pathogenesis and clinical management[J]. BMJ, 2018, 360: j5492.
[6]	Liang B H, Lin W C, Tang Y Y, et al. Selenium supplementation elevated SELENBP1 to inhibit fibroblast activation in pulmonary arterial hypertension[J]. iScience, 2024, 27(10): 111036.
[7]	Rachedi N S, Tang Y, Tai Y Y, et al. Dietary intake and glutamine-serine metabolism control pathologic vascular stiffness[J]. Cell Metab, 2024, 36(6): 1335-1350.e8.
[8]	Zhang H, Li M, Hu C J, et al. Fibroblasts in pulmonary hypertension: roles and molecular mechanisms[J]. Cells, 2024, 13(11): 914.
[9]	Kurose H. Cardiac fibrosis and fibroblasts[J]. Cells, 2021, 10(7): 1716.
[10]	Gibb A A, Lazaropoulos M P, Elrod J W. Myofibroblasts and fibrosis: mitochondrial and metabolic control of cellular differentiation[J]. Circ Res, 2020, 127(3): 427-447.
[11]	Seok B G, Lee S, Jin S H, et al. Inhibiting mitoNEET restores mitochondrial redox homeostasis and attenuates myofibroblast differentiation[J]. Free Radic Biol Med, 2025, 238: 293-302.
[12]	Halling J F, Pilegaard H. PGC-1α-mediated regulation of mitochondrial function and physiological implications[J]. Appl Physiol Nutr Metab, 2020, 45(9): 927-936.
[13]	Abu Shelbayeh O, Arroum T, Morris S, et al. PGC-1α is a master regulator of mitochondrial lifecycle and ROS stress response[J]. Antioxidants (Basel), 2023, 12(5): 1075.
[14]	Evans C E, Cober N D, Dai Z Y, et al. Endothelial cells in the pathogenesis of pulmonary arterial hypertension[J]. Eur Respir J, 2021, 58(3): 2003957.
[15]	Shen H, Gao Y, Ge D D, et al. BRCC3 regulation of ALK2 in vascular smooth muscle cells: implication in pulmonary hypertension[J]. Circulation, 2024, 150(2): 132-150.
[16]	MacKay C D A, Jadli A S, Fedak P W M, et al. Adventitial fibroblasts in aortic aneurysm: unraveling pathogenic contributions to vascular disease[J]. Diagnostics (Basel), 2022, 12(4): 871.
[17]	Younesi F S, Miller A E, Barker T H, et al. Fibroblast and myofibroblast activation in normal tissue repair and fibrosis[J]. Nat Rev Mol Cell Biol, 2024, 25(8): 617-638.
[18]	Wang A, Valdez-Jasso D. Cellular mechanosignaling in pulmonary arterial hypertension[J]. Biophys Rev, 2021, 13(5): 747-756.
[19]	Humbert M, Guignabert C, Bonnet S, et al. Pathology and pathobiology of pulmonary hypertension: state of the art and research perspectives[J]. Eur Respir J, 2019, 53(1): 1801887.
[20]	Wang D R, Zhang H, Li M, et al. microRNA-124 controls the proliferative, migratory, and inflammatory phenotype of pulmonary vascular fibroblasts[J]. Circ Res, 2014, 114(1): 67-78.
[21]	Chelladurai P, Boucherat O, Stenmark K, et al. Targeting histone acetylation in pulmonary hypertension and right ventricular hypertrophy[J]. Br J Pharmacol, 2021, 178(1): 54-71.
[22]	Khatun J, Gelles J D, Chipuk J E. Dynamic death decisions: how mitochondrial dynamics shape cellular commitment to apoptosis and ferroptosis[J]. Dev Cell, 2024, 59(19): 2549-2565.
[23]	Newmeyer D D, Ferguson-Miller S. Mitochondria: releasing power for life and unleashing the machineries of death[J]. Cell, 2003, 112(4): 481-490.
[24]	Su C T, See D H W, Huang Y J, et al. LTBP4 protects against renal fibrosis via mitochondrial and vascular impacts[J]. Circ Res, 2023, 133(1): 71-85.
[25]	Peng F, Liao M R, Jin W K, et al. 2-APQC, a small-molecule activator of Sirtuin-3 (SIRT3), alleviates myocardial hypertrophy and fibrosis by regulating mitochondrial homeostasis[J]. Signal Transduct Target Ther, 2024, 9(1): 133.
[26]	Ahangari F, Price N L, Malik S, et al. microRNA-33 deficiency in macrophages enhances autophagy, improves mitochondrial homeostasis, and protects against lung fibrosis[J]. JCI Insight, 2023, 8(4): e158100.
[27]	Zhang T, Liu C F, Zhang T N, et al. Overexpression of peroxisome proliferator-activated receptor γ coactivator 1-α protects cardiomyocytes from lipopolysaccharide-induced mitochondrial damage and apoptosis[J]. Inflammation, 2020, 43(5): 1806-1820.
[28]	Humeres C, Shinde A V, Tuleta I, et al. Fibroblast Smad7 induction protects the remodeling pressure-overloaded heart[J]. Circ Res, 2024, 135(3): 453-469.
[29]	Tie Y, Tang F, Peng D D, et al. TGF-beta signal transduction: biology, function and therapy for diseases[J]. Mol Biomed, 2022, 3(1): 45.
[30]	Kumar A P, Puthussery D T. Regulation of PPAR-γ coactivator-1α and its implication in mitochondrial function and neurodegenerative diseases[J]. Ageing Res Rev, 2025, 112: 102887.
[31]	Huang T, Zhang T Y, Gao J Q. Targeted mitochondrial delivery: a therapeutic new era for disease treatment[J]. J Control Release, 2022, 343: 89-106.
[32]	Tohme C, Haykal T, Yang R Q, et al. ZLN005, a PGC-1α activator, protects the liver against ischemia-reperfusion injury and the progression of hepatic metastases[J]. Cells, 2024, 13(17): 1448.
[33]	Zhu P F, Ma H J, Cui S C, et al. ZLN005 alleviates in vivo and in vitro renal fibrosis via PGC-1α-mediated mitochondrial homeostasis[J]. Pharmaceuticals (Basel), 2022, 15(4): 434.
[34]	Hsu C H, Roan J N, Fang S Y, et al. Transplantation of viable mitochondria improves right ventricular performance and pulmonary artery remodeling in rats with pulmonary arterial hypertension[J]. J Thorac Cardiovasc Surg, 2022, 163(5): e361-e373.
[35]	Gollihue J L, Patel S P, Eldahan K C, et al. Effects of mitochondrial transplantation on bioenergetics, cellular incorporation, and functional recovery after spinal cord injury[J]. J Neurotrauma, 2018, 35(15): 1800-1818.