Mechanism of neutrophil extracellular traps in promoting post-injury airway fibrosis

doi:10.3969/j.issn.1674-8115.2026.09.007

Abstract

Abstract:

Objective ·To investigate the role of neutrophil extracellular traps (NETs) in aberrant repair following airway injury and the underlying mechanisms. Methods ·Patients with airway stenosis caused by granulation tissue or scarring and healthy volunteers were enrolled from The First Affiliated Hospital of Chongqing Medical University between April and October 2024. Peripheral blood, airway granulation tissue, and paracancerous normal airway tissue were collected. The levels of NETs markers—myeloperoxidase (MPO), citrullinated histone H3 (CitH3), and extracellular free double-stranded DNA (dsDNA)—in serum and tissues were detected using enzyme-linked immunosorbent assay (ELISA), immunofluorescence staining, and a dsDNA quantification kit. After stimulation of airway fibroblasts with NETs, the expression levels of α-smooth muscle actin (α-SMA) and collagen Ⅰ (COL1) were examined by real-time quantitative PCR (qPCR), Western blotting, and immunofluorescence staining. Cell proliferation and migration were evaluated using the Cell Counting Kit-8 (CCK-8) assay and Transwell migration assay. The Toll-like receptor 4 (Tlr4) gene in rat airway fibroblasts was knocked down using small interfering RNA (siRNA), and the above indices, as well as phosphorylation levels of SMAD family member 2 (SMAD2), were assessed. A rat airway scraping injury model was established. A diphenyleneiodonium chloride (DPI) pretreatment group and a control group were additionally included. Serum MPO and interleukin-8 (IL-8) levels were measured by ELISA. The expression levels of α-SMA and COL1 in airway tissue were detected by qPCR and Western blotting. Airway tissue structure and the localization and expression of CitH3 were observed using Masson staining and immunofluorescence staining, respectively. Results ·① Patients with airway stenosis exhibited higher levels of serum NETs markers than healthy controls, and increased CitH3 was observed in the granulation tissue. ② After stimulation with NETs, fibroblasts showed elevated expression of α-SMA and COL1, enhanced proliferation and migration abilities, and upregulated SMAD2 phosphorylation; these effects were inhibited by deoxyribonuclease Ⅰ (DNaseⅠ). ③ Knockdown of Tlr4 suppressed the effects induced by NETs. ④ In the rat airway scraping injury model, serum MPO and IL-8 levels were significantly elevated, airway structure was damaged with severe collagen deposition, and the expression levels of α-SMA, COL1, and CitH3 in the airway tissue were increased compared with those in the control group; DPI pretreatment partially attenuated these changes. Conclusion ·NETs may activate fibroblasts via the TLR4/SMAD2 pathway following airway injury, promoting cell migration, proliferation, and extracellular matrix deposition, thereby contributing to airway fibrosis.

Key words: airway injury, neutrophil extracellular traps (NETs), fibroblast, fibrosis

CLC Number:

R562.1⁺2

Huang Danqing, Yin Yuting, Xu Li, Guo Shuliang. Mechanism of neutrophil extracellular traps in promoting post-injury airway fibrosis[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026,(9): 1222-1232.

Figures/Tables 7

Tab 1 Primer sequences of target genes for qPCR in humans and rats

Gene	Species	Sequence (5′→3′)
ACTB	Human	F: TTCCTTCCTGGGCATGGAGTCC R: TGGCGTACAGGTCTTTGCGG
Actb	Rat	F: CCTTTGCCGATCCGCCG R: GATATCATCATCCATGGTGAGCTGG
COL1A1	Human	F: CCCCGAGGCTCTGAAGGT R: GCAATACCAGGAGCACCATTG
Col1a1	Rat	F: CTTTGTGGACCTCCGGCTC R: AGCTGACTTCAGGGATGTCTTC
ACTA2	Human	F: CCCCGGGAGCCAGTCT R: GCTTCACAGGATTCCCGTCT
Acta2	Rat	F: CAGCTATGTGGGGGACGAAG R: AGTGGTGCCAGATCTTTTCCA

Fig 1 Expression and localization of NETs markers in clinical samples

Fig 2 Changes in α‑SMA and COL1 expression in airway fibroblasts after NETs stimulation

Fig 3 Functional changes in airway fibroblasts after stimulation by NETs

Fig 4 Molecular pathway of NETs activating airway fibroblasts

Fig 5 Expression of serum NETs markers and their relationship with fibroblast activation in the rat airway injury model

Fig 6 Expression of NETs markers in airway tissues and their relationship with fibroblast activation in the rat airway injury model

TrendMD

References 30

[1]	Wood D E, Mathisen D J. Late complications of tracheotomy[J]. Clin Chest Med, 1991, 12(3): 597-609.
[2]	Gelbard A, Francis D O, Sandulache V C, et al. Causes and consequences of adult laryngotracheal stenosis[J]. Laryngoscope, 2015, 125(5): 1137-1143.
[3]	Wang T, Zhang J, Qiu X J, et al. Scarring airway stenosis in Chinese adults: characteristics and interventional bronchoscopy treatment[J]. Chin Med J, 2018, 131(3): 276-281.
[4]	Keane T J, Horejs C M, Stevens M M. Scarring vs. functional healing: matrix-based strategies to regulate tissue repair[J]. Adv Drug Deliv Rev, 2018, 129: 407-419.
[5]	Oberg C L, Holden V K, Channick C L. Benign central airway obstruction[J]. Semin Respir Crit Care Med, 2018, 39(6): 731-746.
[6]	Hirshoren N, Eliashar R. Wound-healing modulation in upper airway stenosis: myths and facts[J]. Head Neck, 2009, 31(1): 111-126.
[7]	Hall S R, Allen C T, Merati A L, et al. Evaluating the utility of serological testing in laryngotracheal stenosis[J]. Laryngoscope, 2017, 127(6): 1408-1412.
[8]	Marchioni A, Tonelli R, Andreani A, et al. Molecular mechanisms and physiological changes behind benign tracheal and subglottic stenosis in adults[J]. Int J Mol Sci, 2022, 23(5): 2421.
[9]	Papayannopoulos V. Neutrophil extracellular traps in immunity and disease[J]. Nat Rev Immunol, 2018, 18(2): 134-147.
[10]	Heijink I H, Pouwels S D, Leijendekker C, et al. Cigarette smoke-induced damage-associated molecular pattern release from necrotic neutrophils triggers proinflammatory mediator release[J]. Am J Respir Cell Mol Biol, 2015, 52(5): 554-562.
[11]	Garcia-Romo G S, Caielli S, Vega B, et al. Netting neutrophils are major inducers of type Ⅰ IFN production in pediatric systemic lupus erythematosus[J]. Sci Transl Med, 2011, 3(73): 73ra20.
[12]	Li P X, Li M, Lindberg M R, et al. PAD4 is essential for antibacterial innate immunity mediated by neutrophil extracellular traps[J]. J Exp Med, 2010, 207(9): 1853-1862.
[13]	Hamam H J, Palaniyar N. Post-translational modifications in NETosis and NETs-mediated diseases[J]. Biomolecules, 2019, 9(8): 369.
[14]	Kolaczkowska E, Jenne C N, Surewaard B G, et al. Molecular mechanisms of NET formation and degradation revealed by intravital imaging in the liver vasculature[J]. Nat Commun, 2015, 6: 6673.
[15]	Chrysanthopoulou A, Mitroulis I, Apostolidou E, et al. Neutrophil extracellular traps promote differentiation and function of fibroblasts[J]. J Pathol, 2014, 233(3): 294-307.
[16]	Nakazawa D, Kumar S V, Marschner J, et al. Histones and neutrophil extracellular traps enhance tubular necrosis and remote organ injury in ischemic AKI[J]. J Am Soc Nephrol, 2017, 28(6): 1753-1768.
[17]	Narayana Moorthy A, Narasaraju T, Rai P, et al. In vivo and in vitro studies on the roles of neutrophil extracellular traps during secondary pneumococcal pneumonia after primary pulmonary influenza infection[J]. Front Immunol, 2013, 4: 56.
[18]	Brinkmann V, Reichard U, Goosmann C, et al. Neutrophil extracellular traps kill bacteria[J]. Science, 2004, 303(5663): 1532-1535.
[19]	Rosazza T, Warner J, Sollberger G. NET formation: mechanisms and how they relate to other cell death pathways[J]. FEBS J, 2021, 288(11): 3334-3350.
[20]	Li H T, Li Y, Song C, et al. Neutrophil extracellular traps augmented alveolar macrophage pyroptosis via AIM2 inflammasome activation in LPS-induced ALI/ARDS[J]. J Inflamm Res, 2021, 14: 4839-4858.
[21]	Saffarzadeh M, Juenemann C, Queisser M A, et al. Neutrophil extracellular traps directly induce epithelial and endothelial cell death: a predominant role of histones[J]. PLoS One, 2012, 7(2): e32366.
[22]	Suzuki M, Ikari J, Anazawa R, et al. PAD4 deficiency improves bleomycin-induced neutrophil extracellular traps and fibrosis in mouse lung[J]. Am J Respir Cell Mol Biol, 2020, 63(6): 806-818.
[23]	Lorenz R R. Adult laryngotracheal stenosis: etiology and surgical management[J]. Curr Opin Otolaryngol Head Neck Surg, 2003, 11(6): 467-472.
[24]	Hofbauer T M, Mangold A, Scherz T, et al. Neutrophil extracellular traps and fibrocytes in ST-segment elevation myocardial infarction[J]. Basic Res Cardiol, 2019, 114(5): 33.
[25]	Wong S L, Demers M, Martinod K, et al. Diabetes primes neutrophils to undergo NETosis, which impairs wound healing[J]. Nat Med, 2015, 21(7): 815-819.
[26]	Matthay M A, Ware L B, Zimmerman G A. The acute respiratory distress syndrome[J]. J Clin Invest, 2012, 122(8): 2731-2740.
[27]	Freitag L, Darwiche K. Endoscopic treatment of tracheal stenosis[J]. Thorac Surg Clin, 2014, 24(1): 27-40.
[28]	Hori M, Nishida K. Toll-like receptor signaling: defensive or offensive for the heart?[J]. Circ Res, 2008, 102(2): 137-139.
[29]	Hung C F, Rohani M G, Lee S S, et al. Role of IGF-1 pathway in lung fibroblast activation[J]. Respir Res, 2013, 14(1): 102.
[30]	Vazquez-Torres A, Vallance B A, Bergman M A, et al. Toll-like receptor 4 dependence of innate and adaptive immunity to Salmonella: importance of the Kupffer cell network[J]. J Immunol, 2004, 172(10): 6202-6208.