Mechanistic study of targeting melanoma with STING pathway deficiencies via PIKfyve inhibitor

doi:10.3969/j.issn.1674-8115.2025.09.005

Abstract

Abstract:

Objective ·To explore the antitumor effects and potential mechanisms of combining phosphoinositide 3-kinase, FYVE-type zinc finger containing (PIKfyve) inhibitor YM201636 with the stimulator of interferon genes (STING) agonist diABZI in STINGpathway-deficient melanoma. Methods ·The mRNA and protein expression levels of STING in human cancer cell lines were obtained from the Cancer Cell Line Encyclopedia (CCLE) and UniProt databases. Based on median expression values, melanoma cell lines with high STING mRNA but low protein expression were identified. Quantitative real-time PCR (qRT-PCR) and Western blotting were performed to validate STING mRNA and protein expression in human melanoma cells. The murine melanoma cell line YUMM1.7, characterized by low STING protein expression, was selected through Western blotting. The ability of YM201636 to restore STING protein expression in YUMM1.7 cells was evaluated. STING agonist diABZI was then applied in combination with YM201636 to analyze the synergistic tumor cell-killing effect through CCK-8 assay. Western blotting was used to detect the phosphorylation of TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3), and qRT-PCR was used to evaluate type Ⅰ interferon expression. A mouse melanoma model was established and treated with YM201636, diABZI, or their combination. Tumor volume was measured, and treatment efficacy was assessed. RNA sequencing and immunofluorescence staining were performed to analyze immune cell infiltration in the tumor microenvironment. Results ·Database analyses, qRT-PCR, and Western blotting confirmed that some human melanoma cell lines exhibited high STING mRNA expression but low STING protein levels. YM201636 significantly increased STING protein expression in YUMM1.7 cells (P<0.001). Combined treatment with YM201636 and diABZI significantly enhanced phosphorylation of TBK1 and IRF3 (P<0.05), indicating effective activation of the STING signaling pathway. This combination also promoted the expression of type Ⅰ interferons (P<0.001) and enhanced tumor cell killing in vitro. In vivo, the combination therapy markedly suppressed melanoma growth compared to monotherapy. Immune profiling of the tumor microenvironment revealed significantly increased infiltration of CD4⁺ T cells and CD8⁺ T cells in the combination treatment group (P<0.05). Conclusion ·The PIKfyve inhibitor YM201636 could restore STING protein expression in STING-deficient melanoma and enhance the antitumor efficacy of the STING agonist diABZI, offering a promising therapeutic strategy for tumors with defective STING signaling.

Key words: melanoma, STING agonist, PIKfyve inhibitor

CLC Number:

R739.7

YANG Xiaoyu, HUANG Rui, WU Yijia, ZHANG Zhe, FANG Yan, SHEN Jianfeng. Mechanistic study of targeting melanoma with STING pathway deficiencies via PIKfyve inhibitor[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(9): 1126-1137.

Figures/Tables 7

Tab 1 Primer sequences for qRT-PCR

Gene	Species	Forward (5'→3')	Reverse (5'→3')
Ifna	Mouse	TGCCCAGCAGATCAAGAAGG	TCAGGGGAAATTCCTGCACC
Ifnb1	Mouse	CGTGGGAGATGTCCTCAACT	CCTGAAGATCTCTGCTCGGAC
Cxcl9	Mouse	TCGGACTTCACTCCAACACA	CCTTATCACTAGGGTTCCTCGAA
Cxcl10	Mouse	CCACGTGTTGAGATCATTGCC	TCACTCCAGTTAAGGAGCCC
β-actin	Mouse	ATCTTCCGCCTTAATACT	GCCTTCATACATCAAGTT
STING	Human	GCTGCTGTCTCCCCATTCAG	GCTGGATGCAGGTTGGAGTA
β-actin	Human	CTCCATCCTGGCCTCGCTGT	GCTGTCACCTTCACCGTTCC

Fig 1 Expression of STING mRNA and protein in human melanoma

Fig 2 Synergistic activation of the STING signaling pathway by YM201636 and diABZI

Fig 3 Synergistic antitumor effect of YM201636 and diABZI in tumor cell killing

Fig 4 Antitumor efficacy of combined diABZI and YM201636 treatment in mice with established murine melanoma

Fig 5 Combination of diABZI and YM201636 led to a marked upregulation of immune-associated gene expression

Fig 6 Combination of diABZI and YM201636 reprogrammed the tumor immune microenvironment

TrendMD

References 27

[1]	GULEN M F, KOCH U, HAAG S M, et al. Signalling strength determines proapoptotic functions of STING[J]. Nat Commun, 2017, 8(1): 427.
[2]	WANG J, LI S X, WANG M, et al. STING licensing of type Ⅰ dendritic cells potentiates antitumor immunity[J]. Sci Immunol, 2024, 9(92): eadj3945.
[3]	WANG H, HU S Q, CHEN X, et al. cGAS is essential for the antitumor effect of immune checkpoint blockade[J]. Proc Natl Acad Sci USA, 2017, 114(7): 1637-1642.
[4]	LI L Y, YIN Q, KUSS P, et al. Hydrolysis of 2'3'-cGAMP by ENPP1 and design of nonhydrolyzable analogs[J]. Nat Chem Biol, 2014, 10(12): 1043-1048.
[5]	XIA T L, KONNO H, AHN J, et al. Deregulation of STING signaling in colorectal carcinoma constrains DNA damage responses and correlates with tumorigenesis[J]. Cell Rep, 2016, 14(2): 282-297.
[6]	FALAHAT R, BERGLUND A, PEREZ-VILLARROEL P, et al. Epigenetic state determines the in vivo efficacy of STING agonist therapy[J]. Nat Commun, 2023, 14(1): 1573.
[7]	KONNO H, YAMAUCHI S, BERGLUND A, et al. Suppression of STING signaling through epigenetic silencing and missense mutation impedes DNA damage mediated cytokine production[J]. Oncogene, 2018, 37(15): 2037-2051.
[8]	FALAHAT R, BERGLUND A, PUTNEY R M, et al. Epigenetic reprogramming of tumor cell-intrinsic STING function sculpts antigenicity and T cell recognition of melanoma[J]. Proc Natl Acad Sci USA, 2021, 118(15): e2013598118.
[9]	SHARMA G, GUARDIA C M, ROY A, et al. A family of PIKFYVE inhibitors with therapeutic potential against autophagy-dependent cancer cells disrupt multiple events in lysosome homeostasis[J]. Autophagy, 2019, 15(10): 1694-1718.
[10]	GAYLE S, LANDRETTE S, BEEHARRY N, et al. Identification of apilimod as a first-in-class PIKfyve kinase inhibitor for treatment of B-cell non-Hodgkin lymphoma[J]. Blood, 2017, 129(13): 1768-1778.
[11]	DOĞAN E, DÜZGÜN Z, YILDIRIM Z, et al. The effects of PIKfyve inhibitor YM201636 on claudins and malignancy potential of nonsmall cell cancer cells[J]. Turk J Biol, 2021, 45(1): 26-34.
[12]	GUI X, YANG H, LI T, et al. Autophagy induction via STING trafficking is a primordial function of the cGAS pathway[J]. Nature, 2019, 567(7747): 262-266.
[13]	GONUGUNTA V K, SAKAI T, POKATAYEV V, et al. Trafficking-mediated STING degradation requires sorting to acidified endolysosomes and can be targeted to enhance anti-tumor response[J]. Cell Rep, 2017, 21(11): 3234-3242.
[14]	GENTILI M, LIU B X, PAPANASTASIOU M, et al. ESCRT-dependent STING degradation inhibits steady-state and cGAMP-induced signalling[J]. Nat Commun, 2023, 14(1): 611.
[15]	CLAUDE-TAUPIN A, MOREL E. Phosphoinositides: functions in autophagy-related stress responses[J]. Biochim Biophys Acta Mol Cell Biol Lipids, 2021, 1866(6): 158903.
[16]	ZHENG C F. Protein dynamics in cytosolic DNA-sensing antiviral innate immune signaling pathways[J]. Front Immunol, 2020, 11: 1255.
[17]	SHARMA G, OJHA R, NOGUERA-ORTEGA E, et al. PPT1 inhibition enhances the antitumor activity of anti-PD-1 antibody in melanoma[J]. JCI Insight, 2020, 5(17): e133225.
[18]	RAMANJULU J M, SCOTT PESIRIDIS G, YANG J S, et al. Design of amidobenzimidazole STING receptor agonists with systemic activity[J]. Nature, 2018, 564(7736): 439-443.
[19]	MOTEDAYEN AVAL L, PEASE J E, SHARMA R, et al. Challenges and opportunities in the clinical development of STING agonists for cancer immunotherapy[J]. J Clin Med, 2020, 9(10): 3323.
[20]	AMOUZEGAR A, CHELVANAMBI M, FILDERMAN J N, et al. STING agonists as cancer therapeutics[J]. Cancers (Basel), 2021, 13(11): 2695.
[21]	HANSON M C, CRESPO M P, ABRAHAM W, et al. Nanoparticulate STING agonists are potent lymph node-targeted vaccine adjuvants[J]. J Clin Invest, 2015, 125(6): 2532-2546.
[22]	KIM D S, ENDO A, FANG F G, et al. E7766, a macrocycle-bridged stimulator of interferon genes (STING) agonist with potent pan-genotypic activity[J]. ChemMedChem, 2021, 16(11): 1740-1743.
[23]	PAN B S, PERERA S A, PIESVAUX J A, et al. An orally available non-nucleotide STING agonist with antitumor activity[J]. Science, 2020, 369(6506): eaba6098.
[24]	PAYNE S H. The utility of protein and mRNA correlation[J]. Trends Biochem Sci, 2015, 40(1): 1-3.
[25]	YANG J H, LUO Z Y, MA J Y, et al. A next-generation STING agonist MSA-2: from mechanism to application[J]. J Control Release, 2024, 371: 273-287.
[26]	XIA T L, KONNO H, AHN J, et al. Deregulation of STING signaling in colorectal carcinoma constrains DNA damage responses and correlates with tumorigenesis[J]. Cell Rep, 2016, 14(2): 282-297.
[27]	WANG L, LIANG Z D, GUO Y Z, et al. STING agonist diABZI enhances the cytotoxicity of T cell towards cancer cells[J]. Cell Death Dis, 2024, 15(4): 265.