
Journal of Shanghai Jiao Tong University (Medical Science) ›› 2022, Vol. 42 ›› Issue (4): 422-432.doi: 10.3969/j.issn.1674-8115.2022.04.004
• High-risk pregnancy column • Previous Articles Next Articles
WU Xiafei1(
), FANG Jie1, QI Hongbo1,2, YU Xinyang1(
)
Received:2021-12-01
Accepted:2022-03-16
Online:2022-04-28
Published:2022-04-28
Contact:
YU Xinyang
E-mail:cq_wxf@163.com;yu_xinyoung@163.com
Supported by:CLC Number:
WU Xiafei, FANG Jie, QI Hongbo, YU Xinyang. Neuropsychiatric effects of gestational diabetes mellitus in adult offspring in C57BL/6J mice[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(4): 422-432.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2022.04.004
| Gene | Forward primer | Reverse primer |
|---|---|---|
| β-actin | CACTGTCGAGTCGCGTCC | TCATCCATGGCGAACTGGTG |
| Drd1 | AGGTTGAGCAGGACATACGC | TTGCTTCTGGGCAATCCTGT |
| Htr2a | CTGATTCCTCTCTGTGCGCT | TCCAGCACGGTTGAAGTCTG |
| Bdnf | TAAACGTCCACGGACAAGGC | TCGTCAGACCTCTCGAACCT |
| Creb1 | GAAGAGACTTCTGCCCTCCG | GAAGAGACTTCTGCCCTCCC |
Tab 1 Primer sequence for RT-qPCR(5′→3′)
| Gene | Forward primer | Reverse primer |
|---|---|---|
| β-actin | CACTGTCGAGTCGCGTCC | TCATCCATGGCGAACTGGTG |
| Drd1 | AGGTTGAGCAGGACATACGC | TTGCTTCTGGGCAATCCTGT |
| Htr2a | CTGATTCCTCTCTGTGCGCT | TCCAGCACGGTTGAAGTCTG |
| Bdnf | TAAACGTCCACGGACAAGGC | TCGTCAGACCTCTCGAACCT |
| Creb1 | GAAGAGACTTCTGCCCTCCG | GAAGAGACTTCTGCCCTCCC |
| 1 | 魏玉梅, 杨慧霞. 我国妊娠期糖尿病研究的发展与展望[J]. 中华围产医学杂志, 2018, 21(4): 218-220. |
| WEI Y M, YANG H X. Development and prospect of research on gestational diabetes mellitus in China[J]. Chin J Perinat Med, 2018, 21(4): 218-220. | |
| 2 | BOLTON J L, BILBO S D. Developmental programming of brain and behavior by perinatal diet: focus on inflammatory mechanisms[J]. Dialogues Clin Neurosci, 2014, 16(3): 307-320. |
| 3 | SOUSA R, TORRES Y S, FIGUEIREDO C P, et al. Consequences of gestational diabetes to the brain and behavior of the offspring[J]. An Acad Bras Cienc, 2018, 90(2 suppl 1): 2279-2291. |
| 4 | GAWLIŃSKA K, GAWLIŃSKI D, KOROSTYŃSKI M, et al. Maternal dietary patterns are associated with susceptibility to a depressive-like phenotype in rat offspring[J]. Dev Cogn Neurosci, 2021, 47: 100879. |
| 5 | FARAHVAR S, WALFISCH A, SHEINER E. Gestational diabetes risk factors and long-term consequences for both mother and offspring: a literature review[J]. Expert Rev Endocrinol Metab, 2019, 14(1): 63-74. |
| 6 | NOMURA Y, MARKS D J, GROSSMAN B, et al. Exposure to gestational diabetes mellitus and low socioeconomic status: effects on neurocognitive development and risk of attention-deficit/hyperactivity disorder in offspring[J]. Arch Pediatr Adolesc Med, 2012, 166(4): 337-343. |
| 7 | 王晓瑜, 朱岷, 程昕然. 妊娠糖尿病对子代神经发育的研究进展[J]. 四川医学, 2020, 41(10): 1083-1089. |
| WANG X Y, ZHU M, CHENG X R. Research progress of gestational diabetes mellitus on offspring neurodevelopment[J]. Sichuan Med J, 2020, 41(10): 1083-1089. | |
| 8 | VAN LIESHOUT R J, VORUGANTI L P. Diabetes mellitus during pregnancy and increased risk of schizophrenia in offspring: a review of the evidence and putative mechanisms[J]. J Psychiatry Neurosci, 2008, 33(5): 395-404. |
| 9 | VUONG B, ODERO G, ROZBACHER S, et al. Exposure to gestational diabetes mellitus induces neuroinflammation, derangement of hippocampal neurons, and cognitive changes in rat offspring[J]. J Neuroinflammation, 2017, 14(1): 80. |
| 10 | BORA E, HARRISON B J, DAVEY C G, et al. Meta-analysis of volumetric abnormalities in cortico-striatal-pallidal-thalamic circuits in major depressive disorder[J]. Psychol Med, 2012, 42(4): 671-681. |
| 11 | HAYASAKA S, NAKAMURA M, NODA Y, et al. Lateralized hippocampal volume increase following high-frequency left prefrontal repetitive transcranial magnetic stimulation in patients with major depression[J]. Psychiatry Clin Neurosci, 2017, 71(11): 747-758. |
| 12 | SEXTON C E, MACKAY C E, EBMEIER K P. A systematic review and meta-analysis of magnetic resonance imaging studies in late-life depression[J]. Am J Geriatr Psychiatry, 2013, 21(2): 184-195. |
| 13 | DABELEA D, KNOWLER W C, PETTITT D J. Effect of diabetes in pregnancy on offspring: follow-up research in the Pima Indians[J]. J Matern Fetal Med, 2000, 9(1): 83-88. |
| 14 | LAWLOR D A, LICHTENSTEIN P, LÅNGSTRÖM N. Association of maternal diabetes mellitus in pregnancy with offspring adiposity into early adulthood: sibling study in a prospective cohort of 280,866 men from 248,293 families[J]. Circulation, 2011, 123(3): 258-265. |
| 15 | CANNON M, JONES P B, MURRAY R M. Obstetric complications and schizophrenia: historical and meta-analytic review[J]. Am J Psychiatry, 2002, 159(7): 1080-1092. |
| 16 | PANARIELLO F, FANELLI G, FABBRI C, et al. Epigenetic basis of psychiatric disorders: a narrative review[J]. CNS Neurol Disord Drug Targets, 2022, 21(4): 302-315. |
| 17 | KONG L H, CHEN X X, GISSLER M, et al. Relationship of prenatal maternal obesity and diabetes to offspring neurodevelopmental and psychiatric disorders: a narrative review[J]. Int J Obes (Lond), 2020, 44(10): 1981-2000. |
| 18 | JING Y H, SONG Y F, YAO Y M, et al. Retardation of fetal dendritic development induced by gestational hyperglycemia is associated with brain insulin/IGF-I signals[J]. Int J Dev Neurosci, 2014, 37: 15-20. |
| 19 | RIVERA H M, CHRISTIANSEN K J, SULLIVAN E L. The role of maternal obesity in the risk of neuropsychiatric disorders[J]. Front Neurosci, 2015, 9: 194. |
| 20 | PIAZZA F V, SEGABINAZI E, DE MEIRELES A L F, et al. Severe uncontrolled maternal hyperglycemia induces microsomia and neurodevelopment delay accompanied by apoptosis, cellular survival, and neuroinflammatory deregulation in rat offspring hippocampus[J]. Cell Mol Neurobiol, 2019, 39(3): 401-414. |
| 21 | KONG L H, NORSTEDT G, SCHALLING M, et al. The risk of offspring psychiatric disorders in the setting of maternal obesity and diabetes[J]. Pediatrics, 2018, 142(3): e20180776. |
| 22 | ORNOY A. Growth and neurodevelopmental outcome of children born to mothers with pregestational and gestational diabetes[J]. Pediatr Endocrinol Rev, 2005, 3(2): 104-113. |
| 23 | XIANG A H, WANG X H, MARTINEZ MP, et al. Maternal gestational diabetes mellitus, type 1 diabetes, and type 2 diabetes during pregnancy and risk of ADHD in offspring[J]. Diabetes Care, 2018, 41(12): 2502-2508. |
| 24 | VAN LIESHOUT R J, VORUGANTI L P. Diabetes mellitus during pregnancy and increased risk of schizophrenia in offspring: a review of the evidence and putative mechanisms[J]. J Psychiatry Neurosci, 2008, 33(5): 395-404. |
| 25 | RAMANATHAN M, JAISWAL A K, BHATTACHARYA S K. Hyperglycaemia in pregnancy: effects on the offspring behaviour with special reference to anxiety paradigms[J]. Indian J Exp Biol, 2000, 38(3): 231-236. |
| 26 | PENNA E, PIZZELLA A, CIMMINO F, et al. Neurodevelopmental disorders: effect of high-fat diet on synaptic plasticity and mitochondrial functions[J]. Brain Sci, 2020, 10(11): 805. |
| 27 | HASEBE K, KENDIG M D, MORRIS M J. Mechanisms underlying the cognitive and behavioural effects of maternal obesity[J]. Nutrients, 2021, 13(1): 240. |
| 28 | KINNEY B A, RABE M B, JENSEN R A, et al. Maternal hyperglycemia leads to gender-dependent deficits in learning and memory in offspring[J]. Exp Biol Med (Maywood), 2003, 228(2): 152-159. |
| 29 | HUERTA-CERVANTES M, PEÑA-MONTES D J, MONTOYA-PÉREZ R, et al. Gestational diabetes triggers oxidative stress in hippocampus and cerebral cortex and cognitive behavior modifications in rat offspring: age- and sex-dependent effects[J]. Nutrients, 2020, 12(2): 376. |
| 30 | THION M S, LOW D, SILVIN A, et al. Microbiome influences prenatal and adult microglia in a sex-specific manner[J]. Cell, 2018, 172(3): 500-516.e16. |
| 31 | SALES V M, FERGUSON-SMITH A C, PATTI M E. Epigenetic mechanisms of transmission of metabolic disease across generations[J]. Cell Metab, 2017, 25(3): 559-571. |
| 32 | PINNEY S E, SIMMONS R A. Metabolic programming, epigenetics, and gestational diabetes mellitus[J]. Curr Diab Rep, 2012, 12(1): 67-74. |
| 33 | HUERTA-CERVANTES M, PEÑA-MONTES D J, LÓPEZ-VÁZQUEZ M Á, et al. Effects of gestational diabetes in cognitive behavior, oxidative stress and metabolism on the second-generation off-spring of rats[J]. Nutrients, 2021, 13(5): 1575. |
| 34 | ROOZENDAAL B, HAHN E L, NATHAN S V, et al. Glucocorticoid effects on memory retrieval require concurrent noradrenergic activity in the hippocampus and basolateral amygdala[J]. J Neurosci, 2004, 24(37): 8161-8169. |
| 35 | BORA E, FORNITO A, PANTELIS C, et al. Gray matter abnormalities in major depressive disorder: a meta-analysis of voxel based morphometry studies[J]. J Affect Disord, 2012, 138(1/2): 9-18. |
| 36 | MENARD C, PFAU M L, HODES G E, et al. Social stress induces neurovascular pathology promoting depression[J]. Nat Neurosci, 2017, 20(12): 1752-1760. |
| 37 | HARRISON P J. The neuropathology of primary mood disorder[J]. Brain, 2002, 125(Pt 7): 1428-1449. |
| [1] | LIU Qianruo, FANG Zichen, WU Yuhan, ZHONG Xianxin, GUO Muhe, JIA Jie. Research progress in the relationship between gut microbia and its metabolites and gestational diabetes mellitus [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(5): 641-647. |
| [2] | ZHANG Yue, QU Lei, GU Qin, ZHU Yiqing, MA Liying, SUN Wenguang. Effect of continuous positive urine ketone body on clinical outcomes of pregnant women with gestational diabetes mellitus and newborn [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(3): 314-319. |
| [3] | WANG Jie, WU Hui, LU Lingpeng, YANG Kefeng, ZHU Jie, ZHOU Hengyi, YAO Die, GAO Ya, FENG Yuting, LIU Yuhong, JIA Jie. Dynamic changes in gut microbiota of women with gestational diabetes mellitus and the correlation with blood glucose, blood lipid and diet [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(9): 1336-1346. |
| [4] | GAO Fei, LU Yu, DONG Shuqin, YANG Liu, WU Shaohua, WEI Jing. Predictive value of fibroblast growth factor 19 subgroup in early pregnancy on gestational diabetes mellitus [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(7): 898-903. |
| [5] | Qin GU, Yingqian XIA, Yiqing ZHU, Liying MA, Lei QU, Wenguang SUN. Analysis of the effects of individualized one-day outpatient diet guidance on glycemic control, body weight gain rate and pregnancy outcome in pregnant women with gestational diabetes mellitus [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(2): 185-191. |
| [6] | YANG Kefeng, JIA Jie, DING Tianze, ZHANG Shuo, LI Xinyi, ZHU Jie, LIU Yuhong, LU Lingpeng, WU Hui. Association of n-3 polyunsaturated fatty acids and mercury during pregnancy with gestational diabetes mellitus [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(12): 1739-1744. |
| [7] | Dan WU, Li-ping GE. Research progress of DNA methylation in gestational diabetes mellitus [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 1120-1124. |
| [8] | Ning-xin QIN, Wen-long ZHAO, Zhi-yang ZHOU, Wei-hui SHI, Yan-ting WU, He-feng HUANG. Short- and long-term effects of frozen-thawed embryo transfer on offspring [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(5): 653-658. |
| [9] | Yue-hua TU, Xiao-jin WANG, Bing-shun WANG. Effects of individualized nutritional standard meal intervention on the prevention of gestational diabetes in overweight and obese pregnant women [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(3): 360-365. |
| [10] | Qing LIU, Wen CAI, Rui-qing ZHANG, Cong LU, Jia-rong ZHANG, Xian-ming XU. Value of pregnancy lipid tolerance test in predicting risk of gestational diabetes mellitus [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(2): 210-216. |
| [11] | Ya-jie ZHU, Hui LIN, Xi CHEN, Yi-ran ZHAO, Xin-mei LIU, He-feng HUANG. Change of cortisol level in umbilical cord blood of neonates delivered by gestational diabetes mellitus mothers and its influence on offspring health [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(1): 49-54. |
| [12] | ZHANG Yi-jing1, 2, XU Jian1, 2. Effect of maternal vitamin A deficiency during pregnancy on neurodevelopment of offspring [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(9): 1277-1282. |
| [13] | CUI Hui-ru, LI Wei, PANG Jiao-yan, LI Hui, LI Chun-bo. Level of intolerance of uncertainty and related factors in patients with anxiety disorders [J]. , 2020, 40(3): 346-. |
| [14] | GUO Yan-yan, GUO Fei, LI Tong, LI Yu-chen, HUANG He-feng, LIU Xin-mei. Changes and significance of coagulation indexes in pregnant women with gestational diabetes mellitus [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(12): 1614-1617. |
| [15] | WU Ke1, SUN Han-xiao2, CAI Mei-qin1. Research progress of effect of carotenoids on maternal and child health [J]. , 2019, 39(8): 929-. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||