
Journal of Shanghai Jiao Tong University (Medical Science) ›› 2023, Vol. 43 ›› Issue (5): 580-591.doi: 10.3969/j.issn.1674-8115.2023.05.008
• Basic research • Previous Articles Next Articles
HU Yu1,2,3(
), XIE Liang1,2,4,5, ZOU Dan3, FU Hongling1,2, LOU Lili1,2, XIE Keqi3, LIU Hanmin1,2,4,5(
)
Received:2023-03-31
Accepted:2023-01-03
Online:2023-05-28
Published:2023-07-11
Contact:
LIU Hanmin
E-mail:976700544@qq.com;liuhm@scu.edu.cn
Supported by:CLC Number:
HU Yu, XIE Liang, ZOU Dan, FU Hongling, LOU Lili, XIE Keqi, LIU Hanmin. Effect of montelukast on leukotriene B4 metabolism in asthma[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023,(5): 580-591.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2023.05.008
| Primer Name | Direction | Sequence (5′→3′) |
|---|---|---|
| ALOX5AP | Forward | TGTCGGCTATCTGGGAGAGAGA |
| ALOX5AP | Reverse | ATCCGCTTGCCGAAGATGTA |
| LTA4H | Forward | TTGATTGGAACACCTGGCTCTA |
| LTA4H | Reverse | TGTCAGAGTCACGTCGTAATTGG |
| BLT1 | Forward | GGCACTAAGACAGATTCAAGGATT |
| BLT1 | Reverse | ACATGCCACCAGGAGAAGAAG |
| Actin | Forward | TGGCTCCTAGCACCATGAAGA |
| Actin | Reverse | GCCACCGATCCACACAGAGT |
Tab 1 List of primers
| Primer Name | Direction | Sequence (5′→3′) |
|---|---|---|
| ALOX5AP | Forward | TGTCGGCTATCTGGGAGAGAGA |
| ALOX5AP | Reverse | ATCCGCTTGCCGAAGATGTA |
| LTA4H | Forward | TTGATTGGAACACCTGGCTCTA |
| LTA4H | Reverse | TGTCAGAGTCACGTCGTAATTGG |
| BLT1 | Forward | GGCACTAAGACAGATTCAAGGATT |
| BLT1 | Reverse | ACATGCCACCAGGAGAAGAAG |
| Actin | Forward | TGGCTCCTAGCACCATGAAGA |
| Actin | Reverse | GCCACCGATCCACACAGAGT |
| 1 | JOHNSON C C, CHANDRAN A, HAVSTAD S, et al. US childhood asthma incidence rate patterns from the ECHO consortium to identify high-risk groups for primary prevention[J]. JAMA Pediatr, 2021, 175(9): 919-927. |
| 2 | MESHRAM D, BHARDWAJ K, RATHOD C, et al. The role of leukotrienes inhibitors in the management of chronic inflammatory diseases[J]. Recent Pat Inflamm Allergy Drug Discov, 2020, 14(1): 15-31. |
| 3 | YAMAMOTO T, MIYATA J, ARITA M, et al. Current state and future prospect of the therapeutic strategy targeting cysteinyl leukotriene metabolism in asthma[J]. Respir Investig, 2019, 57(6): 534-543. |
| 4 | NIALS A T, UDDIN S. Mouse models of allergic asthma: acute and chronic allergen challenge[J]. Dis Model Mech, 2008, 1(4/5): 213-220. |
| 5 | LOCKE N R, ROYCE S G, WAINEWRIGHT J S, et al. Comparison of airway remodeling in acute, subacute, and chronic models of allergic airways disease[J]. Am J Respir Cell Mol Biol, 2007, 36(5): 625-632. |
| 6 | PADRID P, SNOOK S, FINUCANE T, et al. Persistent airway hyperresponsiveness and histologic alterations after chronic antigen challenge in cats[J]. Am J Respir Crit Care Med, 1995, 151(1): 184-193. |
| 7 | CHO K S, PARK M K, KANG S A, et al. Adipose-derived stem cells ameliorate allergic airway inflammation by inducing regulatory T cells in a mouse model of asthma[J]. Mediators Inflamm, 2014, 2014: 436476. |
| 8 | MIYATA J, FUKUNAGA K, KAWASHIMA Y, et al. Cysteinyl leukotriene metabolism of human eosinophils in allergic disease[J]. Allergol Int, 2020, 69(1): 28-34. |
| 9 | BRUNO F, SPAZIANO G, LIPARULO A, et al. Recent advances in the search for novel 5-lipoxygenase inhibitors for the treatment of asthma[J]. Eur J Med Chem, 2018, 153: 65-72. |
| 10 | LECHNER A, HENKEL F D R, HARTUNG F, et al. Macrophages acquire a TNF-dependent inflammatory memory in allergic asthma[J]. J Allergy Clin Immunol, 2022, 149(6): 2078-2090. |
| 11 | RO M, LEE A J, KIM J H. 5-/ 12-Lipoxygenase-linked cascade contributes to the IL-33-induced synthesis of IL-13 in mast cells, thus promoting asthma development[J]. Allergy, 2018, 73(2): 350-360. |
| 12 | DOHERTY T A, KHORRAM N, LUND S, et al. Lung type 2 innate lymphoid cells express cysteinyl leukotriene receptor 1, which regulates TH2 cytokine production[J]. J Allergy Clin Immunol, 2013, 132(1): 205-213. |
| 13 | THIVIERGE M, STANKOVÁ J, ROLA-PLESZCZYNSKI M. IL-13 and IL-4 up-regulate cysteinyl leukotriene 1 receptor expression in human monocytes and macrophages[J]. J Immunol, 2001, 167(5): 2855-2860. |
| 14 | ZHOU X J, QIN Z, LU J, et al. Efficacy and safety of salmeterol/fluticasone compared with montelukast alone (or add-on therapy to fluticasone) in the treatment of bronchial asthma in children and adolescents: a systematic review and meta-analysis[J]. Chin Med J, 2021, 134(24): 2954-2961. |
| 15 | DEBELLEIX S, SIAO-HIM FA V, BEGUERET H, et al. Montelukast reverses airway remodeling in actively sensitized young mice[J]. Pediatr Pulmonol, 2018, 53(6): 701-709. |
| 16 | WANG W L, LUO X M, ZHANG Q, et al. Bifidobacterium infantis relieves allergic asthma in mice by regulating Th1/Th2[J]. Med Sci Monit, 2020, 26: e920583. |
| 17 | SUN W, LIU H Y. Montelukast and budesonide for childhood cough variant asthma[J]. J Coll Physicians Surg Pak, 2019, 29(4): 345-348. |
| 18 | ELIEH ALI KOMI D, BJERMER L. Mast cell-mediated orchestration of the immune responses in human allergic asthma: current insights[J]. Clin Rev Allergy Immunol, 2019, 56(2): 234-247. |
| 19 | BRIGHTLING C E, BRUSSELLE G, ALTMAN P. The impact of the prostaglandin D2 receptor 2 and its downstream effects on the pathophysiology of asthma[J]. Allergy, 2020, 75(4): 761-768. |
| 20 | SCHEXNAYDRE E E, GERSTMEIER J, GARSCHA U, et al. A 5‑lipoxygenase-specific sequence motif impedes enzyme activity and confers dependence on a partner protein[J]. Biochim Biophys Acta Mol Cell Biol Lipids, 2019, 1864(4): 543-551. |
| 21 | MUÑOZ N M, MELITON A Y, MELITON L N, et al. Secretory group V phospholipase A2 regulates acute lung injury and neutrophilic inflammation caused by LPS in mice[J]. Am J Physiol Lung Cell Mol Physiol, 2009, 296(6): L879-L887. |
| 22 | LESLIE C C. Cytosolic phospholipase A₂: physiological function and role in disease[J]. J Lipid Res, 2015, 56(8): 1386-1402. |
| 23 | SOKOLOWSKA M, STEFANSKA J, WODZ-NASKIEWICZ K, et al. Cytosolic phospholipase A2 group IVA is overexpressed in patients with persistent asthma and regulated by the promoter microsatellites[J]. J Allergy Clin Immunol, 2010, 125(6): 1393-1395. |
| 24 | GRANATA F, STAIANO R I, LOFFREDO S, et al. The role of mast cell-derived secreted phospholipases A2 in respiratory allergy[J]. Biochimie, 2010, 92(6): 588-593. |
| 25 | TOUQUI L. Antisense inhibition of phospholipase A2: a new approach for already tested therapeutic targets for the treatment of sepsis[J]. Crit Care Med, 2012, 40(7): 2250-2251. |
| 26 | ZAMAN K, HANIGAN M H, SMITH A, et al. Endogenous S-nitrosoglutathione modifies 5-lipoxygenase expression in airway epithelial cells[J]. Am J Respir Cell Mol Biol, 2006, 34(4): 387-393. |
| 27 | KOGA T, SASAKI F, SAEKI K, et al. Expression of leukotriene B4 receptor 1 defines functionally distinct DCs that control allergic skin inflammation[J]. Cell Mol Immunol, 2021, 18(6): 1437-1449. |
| 28 | PAL K, FENG X, STEINKE J W, et al. Leukotriene A4 hydrolase activation and leukotriene B4 production by eosinophils in severe asthma[J]. Am J Respir Cell Mol Biol, 2019, 60(4): 413-419. |
| 29 | HE R, CHEN Y, CAI Q. The role of the LTB4-BLT1 axis in health and disease[J]. Pharmacol Res, 2020, 158: 104857. |
| 30 | UCHIDA Y, SOMA T, NAKAGOME K, et al. Implications of prostaglandin D2 and leukotrienes in exhaled breath condensates of asthma[J]. Ann Allergy Asthma Immunol, 2019, 123(1): 81-88.e1. |
| 31 | PREEZ S D, RAIDAL S L, DORAN G S, et al. Exhaled breath condensate hydrogen peroxide, pH and leukotriene B4 are associated with lower airway inflammation and airway cytology in the horse[J]. Equine Vet J, 2019, 51(1): 24-32. |
| 32 | STAPLETON R D, SURATT B T, NEFF M J, et al. Bronchoalveolar fluid and plasma inflammatory biomarkers in contemporary ARDS patients[J]. Biomarkers, 2019, 24(4): 352-359. |
| 33 | BERRY K A, BORGEAT P, GOSSELIN J, et al. Urinary metabolites of leukotriene B4 in the human subject[J]. J Biol Chem, 2003, 278(27): 24449-24460. |
| 34 | LEE J J, DIMINA D, MACIAS M P, et al. Defining a link with asthma in mice congenitally deficient in eosinophils[J]. Science, 2004, 305(5691): 1773-1776. |
| 35 | ASANUMA F, KUWABARA K, ARIMURA A, et al. Effects of leukotriene B4 receptor antagonist, LY293111Na, on antigen-induced bronchial hyperresponsiveness and leukocyte infiltration in sensitized guinea pigs[J]. Inflamm Res, 2001, 50(3): 136-141. |
| 36 | KUBO M. Mast cells and basophils in allergic inflammation[J]. Curr Opin Immunol, 2018, 54: 74-79. |
| 37 | LEE Y J, KIM C K. Montelukast use over the past 20 years: monitoring of its effects and safety issues[J]. Clin Exp Pediatr, 2020, 63(10): 376-381. |
| [1] | JIANG Yunli, LI Aiqiu, XIAO Yanshang, LI Tiantian, HU Yachen, ZHANG Xiaoxiao, WU Beirong. Application of continuous nursing based on EMS management mode in preschool children with wheezing diseases [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(2): 228-236. |
| [2] | SHI Zelun, WANG Qing, HE Wen, FU Weijia, WANG Yingwen, HAN Xiao, ZHANG Xiaobo. Nanoplastics aggravate severe asthma by inducing DNA damage of alveolar type Ⅱ epithelial cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1391-1405. |
| [3] | ZHAO Yanhong, WANG Chuanping. Review of CD4+ T cell subsets in asthma phenotypes: molecular mechanisms and biologic treatment options [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(8): 1064-1070. |
| [4] | WEN Yajin, HE Wen, HAN Xiao, ZHANG Xiaobo. Exploratory analysis of gut microbiota differences in childhood asthma with different severity [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 655-664. |
| [5] | WANG Yingwen, LI Xiaoling, DAI Jiajia, LIU Fang, HUANG Jianfeng, WANG Libo, ZHANG Xiaobo, FENG Rui. Epidemiological characteristics and risk factors of severe asthma in children: a single-center prospective cohort study [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 665-672. |
| [6] | LI Pengyun, DAI Yinfang, LU Yanhong, YU Xingmei, XU Lina, DI Wujianfeng, HAO Chuangli. Clinical study of exhaled nitric oxide in children with asthma and allergic rhinitis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 673-679. |
| [7] | DANG Xiangyang, TANG Yuyi, LI Weiguo, LIU Enmei. Diagnostic value of fractional exhaled nitric oxide in predicting cough variant asthma in children with chronic cough: a systematic review and meta-analysis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 680-688. |
| [8] | XU Yinglian, TIAN Jing, ZHANG Xiang, ZHAO Shunying. Research progress in the roles of airway epithelial cells in the pathogenesis of asthma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(5): 619-623. |
| [9] | ZHU Siyu, DONG Xiaoyan. New insights in small airway dysfunction of childhood asthma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(4): 500-506. |
| [10] | ZHENG Guimei, TANG Lanfang. Clinical significance of FEV0.5 and FEV0.75 in the determination of pulmonary function in children with bronchial asthma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(10): 1262-1267. |
| [11] | DENG Yuntian, XIONG Wenkui, ZHU Rui, LIU Enmei, LI Xuemei, ZHONG Zhaohui. A case-control study of the relationship between early-life environmental exposure and childhood asthma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(1): 44-51. |
| [12] | KANG Wenhui, CHEN Yiting, ZHAO Anda, LI Rong, LI Shenghui. Research progress of the mechanism of melatonin in the pathogenesis and course of asthma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 667-672. |
| [13] | CHEN Yiting, ZHAO Anda, LI Rong, KANG Wenhui, LI Shenghui. Review of the role of circulating exosomal microRNA in bronchial asthma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(3): 375-380. |
| [14] | YAO Tao, AO Min, PENG Yin-yin, JIANG Li-sha, GUO Shu-liang . Comparison analysis of clinical characteristic of non-organic dyspnea and asthma both with a complaint of dyspnea#br# [J]. , 2017, 37(7): 959-. |
| [15] | WU Lei, XIA Yi-meng, FAN Qiu-wei. Effects of low tidal volume mechanical ventilation and low level of positive end expiratory pressure on respiratory function in patients with asthma under general anesthesia#br# [J]. , 2017, 37(10): 1413-. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||