
Journal of Shanghai Jiao Tong University (Medical Science) ›› 2023, Vol. 43 ›› Issue (9): 1107-1114.doi: 10.3969/j.issn.1674-8115.2023.09.005
• Basic research • Previous Articles Next Articles
LI Qianyu1(
), GUO Wenyun1, QIAN Yifei1, LI Songling2, ZHU Zijun1, LIU Yanfeng1,3(
)
Received:2023-08-16
Accepted:2023-09-18
Online:2023-09-28
Published:2023-09-28
Contact:
LIU Yanfeng
E-mail:qianyu_lli@163.com;lyf7858188@163.com
Supported by:CLC Number:
LI Qianyu, GUO Wenyun, QIAN Yifei, LI Songling, ZHU Zijun, LIU Yanfeng. Study on the significance and mechanism of ASGR1 in hepatocellular carcinoma[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023,(9): 1107-1114.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2023.09.005
| sgRNA | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| Asgr1-sgRNA-1 | CACCGCGCTGCAAGAGCCGTGGAGT | AAACACTCCACGGCTCTTGCAGCGC |
| Asgr1-sgRNA-2 | CACCGGACCATCATCAACTCCGGAG | AAACCTCCGGAGTTGATGATGGTCC |
Tab 1 Sequence for sgRNA (5′→3′)
| sgRNA | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| Asgr1-sgRNA-1 | CACCGCGCTGCAAGAGCCGTGGAGT | AAACACTCCACGGCTCTTGCAGCGC |
| Asgr1-sgRNA-2 | CACCGGACCATCATCAACTCCGGAG | AAACCTCCGGAGTTGATGATGGTCC |
| Primer | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| Actb | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
| Hk2 | TGATCGCCTGCTTATTCACGG | AACCGCCTAGAAATCTCCAGA |
| Pgk1 | ATGTCGCTTTCCAACAAGCTG | GCTCCATTGTCCAAGCAGAAT |
| Pkm2 | GCCGCCTGGACATTGACTC | CCATGAGAGAAATTCAGCCGAG |
Tab 2 Primer sequence for PCR (5′→3′)
| Primer | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| Actb | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
| Hk2 | TGATCGCCTGCTTATTCACGG | AACCGCCTAGAAATCTCCAGA |
| Pgk1 | ATGTCGCTTTCCAACAAGCTG | GCTCCATTGTCCAAGCAGAAT |
| Pkm2 | GCCGCCTGGACATTGACTC | CCATGAGAGAAATTCAGCCGAG |
Fig 5 Bioinformatics analysis of ASGR1 expression in TCGA liver cancer database and verification of mRNA expression levels in mouse liver cancer tissue
| 1 | BRAY F, FERLAY J, SOERJOMATARAM I, et al. Global cancer statistics 2018: globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2018, 68(6): 394-424. |
| 2 | SUNG H, FERLAY J, SIEGEL R L, et al. Global cancer statistics 2020: globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2021, 71(3): 209-249. |
| 3 | SINGAL A G, LAMPERTICO P, NAHON P. Epidemiology and surveillance for hepatocellular carcinoma: new trends[J]. J Hepatol, 2020, 72(2): 250-261. |
| 4 | SINGH M K, DAS B K, CHOUDHARY S, et al. Diabetes and hepatocellular carcinoma: a pathophysiological link and pharmacological management[J]. Biomed Pharmacother, 2018, 106: 991-1002. |
| 5 | ASHWELL G, HARFORD J. Carbohydrate-specific receptors of the liver[J]. Annu Rev Biochem, 1982, 51: 531-554. |
| 6 | TANOWITZ M, HETTRICK L, REVENKO A, et al. Asialoglycoprotein receptor 1 mediates productive uptake of N-acetylgalactosamine-conjugated and unconjugated phosphorothioate antisense oligonucleotides into liver hepatocytes[J]. Nucleic Acids Res, 2017, 45(21): 12388-12400. |
| 7 | 夏梦蝶, 廖韦, 向琼, 等. 去唾液酸糖蛋白受体1在动脉粥样硬化中的研究进展[J]. 中国动脉硬化杂志, 2022, 30(6): 541-545. |
| XIA M D, LIAO W, XIANG Q, et al. Research progress of asialoglycoprotein receptor 1 in atherosclerosis[J]. Chinese Journal of Arteriosclerosis, 2022, 30(6): 541-545. | |
| 8 | DE GALARRETA M R, BRESNAHAN E, MOLINA-SÁNCHEZ P, et al. β-catenin activation promotes immune escape and resistance to anti-PD-1 therapy in hepatocellular carcinoma[J]. Cancer Discov, 2019, 9(8): 1124-1141. |
| 9 | SIEGEL R L, MILLER K D, WAGLE N S, et al. Cancer statistics, 2023[J]. CA A Cancer J Clinicians, 2023, 73(1): 17-48. |
| 10 | RAHIB L, SMITH B D, AIZENBERG R, et al. Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid, liver, and pancreas cancers in the United States[J]. Cancer Res, 2014, 74(11): 2913-2921. |
| 11 | ZHOU J, SUN H C, WANG Z, et al. Guidelines for the diagnosis and treatment of hepatocellular carcinoma (2019 edition)[J]. Liver Cancer, 2020, 9(6): 682-720. |
| 12 | EL-SERAG H B. Hepatocellular carcinoma[J]. N Engl J Med, 2011, 365(12): 1118-1127. |
| 13 | LLOVET J M, KELLEY R K, VILLANUEVA A, et al. Hepatocellular carcinoma[J]. Nat Rev Dis Primers, 2021, 7(1): 6. |
| 14 | Gilbert Ashwell: sweet on science[J]. Nat Med, 2008, 14(6): 608. |
| 15 | GREWAL P K. The ashwell-morell receptor[J]. Methods Enzymol, 2010, 479: 223-241. |
| 16 | SUGAHARA K, TOGASHI H, TAKAHASHI K, et al. Separate analysis of asialoglycoprotein receptors in the right and left hepatic lobes using Tc-GSA SPECT[J]. Hepatology, 2003, 38(6): 1401-1409. |
| 17 | GREWAL P K, UCHIYAMA S, DITTO D, et al. The Ashwell receptor mitigates the lethal coagulopathy of sepsis[J]. Nat Med, 2008, 14(6): 648-655. |
| 18 | WANG J Q, LI L L, HU A, et al. Inhibition of ASGR1 decreases lipid levels by promoting cholesterol excretion[J]. Nature, 2022, 608(7922): 413-420. |
| 19 | RIGOPOULOU E I, ROGGENBUCK D, SMYK D S, et al. Asialoglycoprotein receptor (ASGPR) as target autoantigen in liver autoimmunity: lost and found[J]. Autoimmun Rev, 2012, 12(2): 260-269. |
| 20 | WITZIGMANN D, QUAGLIATA L, SCHENK S H, et al. Variable asialoglycoprotein receptor 1 expression in liver disease: implications for therapeutic intervention[J]. Hepatol Res, 2016, 46(7): 686-696. |
| 21 | GU D, JIN H, JIN G, et al. The asialoglycoprotein receptor suppresses the metastasis of hepatocellular carcinoma via LASS2-mediated inhibition of V-ATPase activity[J]. Cancer Lett, 2016, 379(1): 107-116. |
| 22 | ZHU X X, SONG G Y, ZHANG S Y, et al. Asialoglycoprotein receptor 1 functions as a tumor suppressor in liver cancer via inhibition of STAT3[J]. Cancer Res, 2022, 82(21): 3987-4000. |
| 23 | TONG M, WONG T L, ZHAO H, et al. Loss of tyrosine catabolic enzyme HPD promotes glutamine anaplerosis through mTOR signaling in liver cancer[J]. Cell Rep, 2021, 36(8): 109617. |
| 24 | FAUBERT B, SOLMONSON A, DEBERARDINIS R J. Metabolic reprogramming and cancer progression[J]. Science, 2020, 368(6487): eaaw5473. |
| 25 | YEH Y C, HO H L, WU Y C, et al. AKT1 internal tandem duplications and point mutations are the genetic hallmarks of sclerosing pneumocytoma[J]. Mod Pathol, 2020, 33(3): 391-403. |
| 26 | HÖNIGOVA K, NAVRATIL J, PELTANOVA B, et al. Metabolic tricks of cancer cells[J]. Biochim Biophys Acta BBA Rev Cancer, 2022, 1877(3): 188705. |
| 27 | CAI J, SUN X H, GUO H, et al. Non-metabolic role of UCK2 links EGFR-AKT pathway activation to metastasis enhancement in hepatocellular carcinoma[J]. Oncogenesis, 2020, 9(12): 103. |
| 28 | ICARD P, SIMULA L, WU Z R, et al. Why may citrate sodium significantly increase the effectiveness of transarterial chemoembolization in hepatocellular carcinoma?[J]. Drug Resist Updat, 2021, 59: 100790. |
| 29 | BUONTEMPO F, ERSAHIN T, MISSIROLI S, et al. Inhibition of Akt signaling in hepatoma cells induces apoptotic cell death independent of Akt activation status[J]. Invest New Drugs, 2011, 29(6): 1303-1313. |
| 30 | TIAN L Y, SMIT D J, JÜCKER M. The role of PI3K/AKT/mTOR signaling in hepatocellular carcinoma metabolism[J]. Int J Mol Sci, 2023, 24(3): 2652. |
| [1] | Hao Fengjie, Wang Junqing, Lu Ye. Immune cell traits mediate the association between alcoholic liver disease and hepatocellular carcinoma: a Mendelian randomization and mediation analysis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(7): 961-971. |
| [2] | Gao Linna, Tang Yangyang, Liu Yifan, Xu Junming, Xing Tonghai. Prediction of postoperative prognosis in hepatocellular carcinoma patients undergoing liver transplantation based on preoperative CT imaging combined with clinical indicators [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(5): 642-650. |
| [3] | LI Qianyu, QIAN Yifei, LI Songling, ZHU Zijun, QIN Wenli, LIU Yanfeng, QIU Bijun. Function and mechanism of suppressor of zeste 12 in hepatocellular carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(9): 1138-1148. |
| [4] | ZHU Zijun, QIAN Yife, LI Qianyu, LI Songling, QIN Wenli, LIU Yanfeng. Anaphase-promoting complex subunit 10 promotes hepatocellular carcinoma progression through regulation of the PI3K-AKT-mTOR signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(9): 1171-1182. |
| [5] | PANDIT Roshan, LU Junyao, HE Liheng, BAO Yujie, JI Ping, CHEN Yingying, XU Jie, WANG Ying. Role of tumor necrosis factor-α in coronavirus disease 2019-associated kidney injury [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(1): 1-10. |
| [6] | FAN Qiang, WU Guangbo, ZHAO Jinbo, ZHENG Lei, LUO Meng. Research progress in pathophysiological and molecular mechanism changes during decompensated phase of portal hypertension in liver cirrhosis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(3): 379-384. |
| [7] | Aishanjiang Kedeerya, FU Yi, LAI Donglin, WU Hailong, GONG Wei. An integrated prognostic model of nuclear-encoded mitochondrial gene signature and clinical information for hepatocellular carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(1): 1-12. |
| [8] | YU Li, SU Xiandu, ZHANG Min, LI Yahui, WANG Le. Construction and validation of prognostic risk model for hepatocellular carcinoma based on biological analysis of palmitoyl-associated enzyme long-chain non-coding RNA [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 747-754. |
| [9] | BENEDICK Jun Er Chin, SON Peng, ZHANG Yifan, WANG Junqing, GUO Simin. Research progress of the impact of nonalcoholic fatty liver disease on chronic hepatitis B infection [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(12): 1585-1590. |
| [10] | LU Yu, WANG Hao, BA Qian. Role of gut microbiota in hepatocellular carcinoma: cancer occurrence, progresses and treatments [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(7): 939-944. |
| [11] | HU Zhexuan, ZHANG Xin, WO Lulu, LI Jingchi, WANG Jiao, ZHOU Cixiang, ZHAO Qian. Study on the function of TRMT61A in liver cancer cell and its mechanism [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(6): 742-750. |
| [12] | HU Chanchan, FAN Yi, XU Yuan, HU Zhijian, ZENG Yiming. Lipid metabolism and lung cancer: emerging roles in occurrence, progression, diagnosis and treatment [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(12): 1766-1771. |
| [13] | Yihuan WANG, Ruokun LI, Huanhuan CHONG, Fuhua YAN. Research progress of Gd-EOB-DTPA-enhanced magnetic resonance imaging in the evaluation of biological behavior of hepatocellular carcinoma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(1): 130-134. |
| [14] | Lei XIONG, Qian YI, Ming-fang XU, Jian CHEN. Expression and prognosis analysis of MRPL12 in lung adenocarcinoma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 1033-1040. |
| [15] | WANG Jun-ying1, LI Xin1, YIN Ting-yu2, LIU Jia2, WANG Xiao-dong3, ZHONG Hua1. Effects of bone marrow mesenchymal cells immune thrombocytopenia patients on the biological behaviors of megakaryocytes [J]. , 2018, 38(6): 616-. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||