
Journal of Shanghai Jiao Tong University (Medical Science) ›› 2024, Vol. 44 ›› Issue (12): 1477-1489.doi: 10.3969/j.issn.1674-8115.2024.12.001
• Innovative research team achievement column • Next Articles
ZHANG Yutong(
), HOU Guojun, SHEN Nan(
)
Received:2024-04-02
Accepted:2024-05-16
Online:2024-12-28
Published:2024-12-28
Contact:
SHEN Nan
E-mail:zhangyutong135@126.com;nanshensibs@gmail.com
Supported by:CLC Number:
ZHANG Yutong, HOU Guojun, SHEN Nan. Comparison of human-induced pluripotent stem cell-derived macrophages with peripheral blood-derived macrophages using single-cell genomics[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(12): 1477-1489.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2024.12.001
| Gene | Forward primer (5´→3´) | Reverse primer (5´→3´) |
|---|---|---|
| HLA-DRA | AGCTGTGGACAAAGCCAACCTG | CTCTCAGTTCCACAGGGCTGTT |
| CD68 | CGAGCATCATTCTTTCACCAGCT | ATGAGAGGCAGCAAGATGGACC |
| CD86 | CCATCAGCTTGTCTGTTTCATTCC | GCTGTAATCCAAGGAATGTGGTC |
| MRC1 | AGCCAACACCAGCTCCTCAAGA | CAAAACGCTCGCGCATTGTCCA |
| RPL13A | CTCAAGGTGTTTGACGGCATCC | TACTTCCAGCCAACCTCGTGAG |
Tab 1 Primer sequences for RT-qPCR.
| Gene | Forward primer (5´→3´) | Reverse primer (5´→3´) |
|---|---|---|
| HLA-DRA | AGCTGTGGACAAAGCCAACCTG | CTCTCAGTTCCACAGGGCTGTT |
| CD68 | CGAGCATCATTCTTTCACCAGCT | ATGAGAGGCAGCAAGATGGACC |
| CD86 | CCATCAGCTTGTCTGTTTCATTCC | GCTGTAATCCAAGGAATGTGGTC |
| MRC1 | AGCCAACACCAGCTCCTCAAGA | CAAAACGCTCGCGCATTGTCCA |
| RPL13A | CTCAAGGTGTTTGACGGCATCC | TACTTCCAGCCAACCTCGTGAG |
| Cell type | Marker gene | IPSDM/n(%) | PBDM/n(%) |
|---|---|---|---|
| Total | ‒ | 9 745 | 1 796 |
| Macrophage | CD14, CD68, S100A11, and CD163 | 9 467 (97.15) | 1 794 (99.89) |
| HPC-like cell | HES1, SOX4, CDK6, RUNX1T1, and MECOM | 264 (2.71) | 2 (0.11) |
| Dendritic cell | ITGAM and ITGAX | 14 (0.14) | 0 (0) |
Tab 2 Cell types, the corresponding marker genes and cell numbers in IPSDM and PBDM
| Cell type | Marker gene | IPSDM/n(%) | PBDM/n(%) |
|---|---|---|---|
| Total | ‒ | 9 745 | 1 796 |
| Macrophage | CD14, CD68, S100A11, and CD163 | 9 467 (97.15) | 1 794 (99.89) |
| HPC-like cell | HES1, SOX4, CDK6, RUNX1T1, and MECOM | 264 (2.71) | 2 (0.11) |
| Dendritic cell | ITGAM and ITGAX | 14 (0.14) | 0 (0) |
| Gene | Average log2FC | pct.1 | pct.2 | P value | Adjusted P value |
|---|---|---|---|---|---|
| MAP4K3-DT | 10.399 | 0.497 | 0 | 8.45×10-305 | 1.66×10-301 |
| PNRC2 | 10.246 | 0.498 | 0 | 2.28×10-305 | 4.50×10-302 |
| TENT2 | 10.154 | 0.488 | 0 | 8.07×10-297 | 1.59×10-293 |
| SELENON | 9.884 | 0.402 | 0 | 2.94×10-226 | 5.79×10-223 |
| RAB7B | 9.847 | 0.341 | 0 | 2.27×10-181 | 4.47×10-178 |
| FAAP20 | 9.780 | 0.396 | 0 | 2.85×10-221 | 5.61×10-218 |
| RAB29 | 9.757 | 0.405 | 0 | 1.58×10-228 | 3.11×10-225 |
| UTP11 | 9.677 | 0.370 | 0 | 6.19×10-202 | 1.22×10-198 |
| TMEM35B | 9.662 | 0.377 | 0 | 2.08×10-207 | 4.11×10-204 |
| ELOA | 9.568 | 0.376 | 0 | 7.27×10-207 | 1.43×10-203 |
| EMILIN1 | -3.939 | 0.049 | 0.278 | 7.48×10-244 | 1.47×10-240 |
| CCR5 | -2.685 | 0.147 | 0.319 | 3.16×10-102 | 6.22×10-99 |
| PHLDA3 | -2.645 | 0.160 | 0.430 | 7.26×10-208 | 1.43×10-204 |
| PCM1 | -2.429 | 0.578 | 0.719 | 5.15×10-262 | 1.02×10-258 |
| VAMP3 | -2.383 | 0.424 | 0.679 | 7.93×10-295 | 1.56×10-291 |
| RRM2 | -2.362 | 0.086 | 0.307 | 9.29×10-164 | 1.83×10-160 |
| AGO1 | -2.284 | 0.279 | 0.432 | 7.54×10-97 | 1.49×10-93 |
| ITPKB | -2.238 | 0.166 | 0.279 | 1.49×10-51 | 2.94×10-48 |
| SMC4 | -2.161 | 0.235 | 0.337 | 6.41×10-46 | 1.26×10-42 |
| MAPK14 | -2.077 | 0.372 | 0.499 | 1.82×10-102 | 3.58×10-99 |
Tab 3 Top 10 DEGs with up- and down-regulated fold changes between the macrophages from PBDM and IPSDM
| Gene | Average log2FC | pct.1 | pct.2 | P value | Adjusted P value |
|---|---|---|---|---|---|
| MAP4K3-DT | 10.399 | 0.497 | 0 | 8.45×10-305 | 1.66×10-301 |
| PNRC2 | 10.246 | 0.498 | 0 | 2.28×10-305 | 4.50×10-302 |
| TENT2 | 10.154 | 0.488 | 0 | 8.07×10-297 | 1.59×10-293 |
| SELENON | 9.884 | 0.402 | 0 | 2.94×10-226 | 5.79×10-223 |
| RAB7B | 9.847 | 0.341 | 0 | 2.27×10-181 | 4.47×10-178 |
| FAAP20 | 9.780 | 0.396 | 0 | 2.85×10-221 | 5.61×10-218 |
| RAB29 | 9.757 | 0.405 | 0 | 1.58×10-228 | 3.11×10-225 |
| UTP11 | 9.677 | 0.370 | 0 | 6.19×10-202 | 1.22×10-198 |
| TMEM35B | 9.662 | 0.377 | 0 | 2.08×10-207 | 4.11×10-204 |
| ELOA | 9.568 | 0.376 | 0 | 7.27×10-207 | 1.43×10-203 |
| EMILIN1 | -3.939 | 0.049 | 0.278 | 7.48×10-244 | 1.47×10-240 |
| CCR5 | -2.685 | 0.147 | 0.319 | 3.16×10-102 | 6.22×10-99 |
| PHLDA3 | -2.645 | 0.160 | 0.430 | 7.26×10-208 | 1.43×10-204 |
| PCM1 | -2.429 | 0.578 | 0.719 | 5.15×10-262 | 1.02×10-258 |
| VAMP3 | -2.383 | 0.424 | 0.679 | 7.93×10-295 | 1.56×10-291 |
| RRM2 | -2.362 | 0.086 | 0.307 | 9.29×10-164 | 1.83×10-160 |
| AGO1 | -2.284 | 0.279 | 0.432 | 7.54×10-97 | 1.49×10-93 |
| ITPKB | -2.238 | 0.166 | 0.279 | 1.49×10-51 | 2.94×10-48 |
| SMC4 | -2.161 | 0.235 | 0.337 | 6.41×10-46 | 1.26×10-42 |
| MAPK14 | -2.077 | 0.372 | 0.499 | 1.82×10-102 | 3.58×10-99 |
| 1 | MURRAY P J, WYNN T A. Protective and pathogenic functions of macrophage subsets[J]. Nat Rev Immunol, 2011, 11(11): 723-737. |
| 2 | SHI C, PAMER E G. Monocyte recruitment during infection and inflammation[J]. Nat Rev Immunol, 2011, 11(11): 762-774. |
| 3 | MARCUS R. What is multiple sclerosis?[J]. JAMA, 2022, 328(20): 2078. |
| 4 | STRAUSS-AYALI D, CONRAD S M, MOSSER D M. Monocyte subpopulations and their differentiation patterns during infection[J]. J Leukoc Biol, 2007, 82(2): 244-252. |
| 5 | ZHANG F, WEI K, SLOWIKOWSKI K, et al. Defining inflammatory cell states in rheumatoid arthritis joint synovial tissues by integrating single-cell transcriptomics and mass cytometry[J]. Nat Immunol, 2019, 20(7): 928-942. |
| 6 | MANTOVANI A, ALLAVENA P, MARCHESI F, et al. Macrophages as tools and targets in cancer therapy[J]. Nat Rev Drug Discov, 2022, 21(11): 799-820. |
| 7 | TIAN L, LEI A H, TAN T Y, et al. Macrophage-based combination therapies as a new strategy for cancer immunotherapy[J]. Kidney Dis, 2022, 8(1): 26-43. |
| 8 | TAKAHASHI K, TANABE K, OHNUKI M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors[J]. Cell, 2007, 131(5): 861-872. |
| 9 | TAKAHASHI K, YAMANAKA S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors[J]. Cell, 2006, 126(4): 663-676. |
| 10 | SELVARAJ V, PLANE J M, WILLIAMS A J, et al. Switching cell fate: the remarkable rise of induced pluripotent stem cells and lineage reprogramming technologies[J]. Trends Biotechnol, 2010, 28(4): 214-223. |
| 11 | PIAU O, BRUNET-MANQUAT M, L'HOMME B, et al. Generation of transgene-free hematopoietic stem cells from human induced pluripotent stem cells[J]. Cell Stem Cell, 2023, 30(12): 1610-1623.e7. |
| 12 | PAES B C M F, MOÇO P D, PEREIRA C G, et al. Ten years of iPSC: clinical potential and advances in vitro hematopoietic differentiation[J]. Cell Biol Toxicol, 2017, 33(3): 233-250. |
| 13 | GRSKOVIC M, JAVAHERIAN A, STRULOVICI B, et al. Induced pluripotent stem cells: opportunities for disease modelling and drug discovery[J]. Nat Rev Drug Discov, 2011, 10(12): 915-929. |
| 14 | VAN WILGENBURG B, BROWNE C, VOWLES J, et al. Efficient, long term production of monocyte-derived macrophages from human pluripotent stem cells under partly-defined and fully-defined conditions[J]. PLoS One, 2013, 8(8): e71098. |
| 15 | MUKHERJEE C, HALE C, MUKHOPADHYAY S. A simple multistep protocol for differentiating human induced pluripotent stem cells into functional macrophages[J]. Methods Mol Biol, 2018, 1784: 13-28. |
| 16 | ALASOO K, MARTINEZ F O, HALE C, et al. Transcriptional profiling of macrophages derived from monocytes and iPS cells identifies a conserved response to LPS and novel alternative transcription[J]. Sci Rep, 2015, 5: 12524. |
| 17 | ALSINET C, PRIMO M N, LORENZI V, et al. Robust temporal map of human in vitro myelopoiesis using single-cell genomics[J]. Nat Commun, 2022, 13(1): 2885. |
| 18 | QUAN F, LIANG X, CHENG M J, et al. Annotation of cell types (ACT): a convenient web server for cell type annotation[J]. Genome Med, 2023, 15(1): 91. |
| 19 | ZHANG L, LI Z Y, SKRZYPCZYNSKA K M, et al. Single-cell analyses inform mechanisms of myeloid-targeted therapies in colon cancer[J]. Cell, 2020, 181(2): 442-459.e29. |
| 20 | BIAN Z L, GONG Y D, HUANG T, et al. Deciphering human macrophage development at single-cell resolution[J]. Nature, 2020, 582(7813): 571-576. |
| 21 | DAVIES L C, JENKINS S J, ALLEN J E, et al. Tissue-resident macrophages[J]. Nat Immunol, 2013, 14(10): 986-995. |
| 22 | MALLAPATY S. Revealed: two men in China were first to receive pioneering stem-cell treatment for heart disease[J]. Nature, 2020, 581(7808): 249-250. |
| 23 | TANG X Y, WU S S, WANG D, et al. Human organoids in basic research and clinical applications[J]. Signal Transduct Target Ther, 2022, 7(1): 168. |
| [1] | Du Xin, Li Xuebing, Li Yongwei. Research progress of macrophage metabolic reprogramming in recurrent spontaneous abortion [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(4): 537-544. |
| [2] | Qian Yile, Yao Sai, Chen Sifeng, Li Quanfu, Zhao Meng. Research progress on the molecular mechanisms and targeted interventions of macrophage-mediated myocardial fibrosis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(3): 348-357. |
| [3] | JIANG Qianyu, YAO Chengcheng, JI Ping, WANG Ying. Microenvironmental profiles of wound tissues with accelerated healing properties by HAMA hydrogel [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(8): 969-980. |
| [4] | WANG Lin, XU Ping, ZHANG Qiaoting, TIAN Jun, LOU Xiaoli, WANG Jing. Role of CARD9 in macrophage M1 polarization in severe acute pancreatitis rats [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(8): 981-989. |
| [5] | KERANMU Saitierguli, QIAN Lei, DING Siyi, MAHELIMUHAN Hanati, YANG Xueer, JIA Hao. Research progress of arginine metabolism in the regulation of mesenchymal stem cell function [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(7): 910-915. |
| [6] | HAN Longchuan, LI Yue, ZOU Zhihui, LUO Jing, LI Ruoyi, ZHANG Yingting, TANG Xinxin, TIAN Lihong, LU Yuheng, HUANG Ying, HE Ming, FU Yinkun. Phosphatidylethanolamine promotes macrophage senescence and liver injury by activating endoplasmic reticulum stress [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(6): 693-704. |
| [7] | HUANG Yinghe, ZHAO Guanyu, SUN Yang, HOU Jianji, ZUO Yong. Research progress on macrophage metabolic regulation in wound healing of diabetes mellitus type 2 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(6): 792-799. |
| [8] | TANG Kairan, FENG Chengling, HAN Bangmin. Integrated single-cell and transcriptome sequencing to construct a prognostic model of M2 macrophage-related genes in prostate cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(5): 549-561. |
| [9] | NI Shuyi, JIANG Zhao, WANG Zhongtao, HE Shumei. Effect of salidroside on the immune function of BCG-infected macrophages [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(4): 426-433. |
| [10] | MA Xiuzhen, ZHOU Ni, GUO Siqi, WANG Yuanyuan, MAI Ping. Cannabinoid receptor 1 promotes M1 polarization of macrophages through the Gαi/o/RhoA signaling pathway in mice with acute lung injury [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(2): 161-168. |
| [11] | ZHANG Yesheng, YANG Yijing, HUANG Yiwen, SHI Longyu, WANG Manyuan, CHEN Sisi. Research progress in immune cells regulating drug resistance of tumor cells in tumor microenvironment [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(7): 830-838. |
| [12] | NIU Yuanyuan, WANG Longde, XU Wenjuan, LI Zhengju, ZHANG Ruiting, WU Yuqian. Research progress in the role of M1/M2 polarization of macrophages in different liver diseases [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 509-517. |
| [13] | KONG Ruxin, ZHOU Yaqun, WEI Tingyi, LEI Ming. Function and mechanism of cancer-testis antigen CT63 in chronic myeloid leukemia [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1347-1358. |
| [14] | SONG Wenting, TAO Yue, PAN Yi, MO Xi, CAO Qing. SIRT2 regulates macrophage chemotaxis by de-modifying histone H4K8 lactylation [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(8): 1008-1016. |
| [15] | HOU Zongliang, YANG Qin, LI Shaobai, LEI Ming. Gene expression program analysis of cancer-testis genes [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(8): 945-954. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||