Study on the effect and mechanism of sorting nexin 1 on inhibiting the proliferation and migration of colorectal cancer cells

doi:10.3969/j.issn.1674-8115.2024.09.007

Abstract

Abstract:

Objective ·To explore the expression of sorting nexin 1 (SNX1) in colorectal cancer (CRC) and its impact on the proliferation and migration of CRC cells. Methods ·Transcriptomic data and clinical pathological information of CRC were obtained from The Cancer Genome Atlas (TCGA), Genotype-Tissue Expression (GTEx), and Gene Expression Omnibus (GEO) databases for enrichment analysis with Gene Set Enrichment Analysis (GSEA) software. The expression of SNX1 in CRC tissues and cells was detected by quantitative real-time polymerase chain reaction (qPCR), Western blotting, and immunohistochemistry staining (IHC). Small interfering RNA (siRNA) was used to knock down the expression of SNX1 to observe its effect on tumor cell proliferation and migration. Correlation analysis was conducted to explore the potential molecular mechanisms underlying SNX1-mediated CRC cell migration, and mRNA level validation was performed in SNX1 knockdown cell lines. Results ·Analysis of CRC patients data in TCGA and tissue microarrays revealed that SNX1 expression was downregulated in CRC tissues and correlated with tumor diameter and distant metastasis. Knockdown of SNX1 enhanced tumor cell proliferation and migration. The expression of SNX1 was negatively correlated with metastasis associated in colon cancer 1 (MACC1), mesenchymal to epithelial transition factor (MET), and Notch; knockdown of SNX1 led to upregulation of these genes. Silencing SNX1 resulted in the downregulation of the epithelial marker cadherin 1 (CDH1) and the upregulation of vimentin (VIM) and Snail family transcriptional repressor 1 (SNAI1). Conclusion ·SNX1 expression was significantly downregulated in CRC tissues and correlated with patient prognosis. Low expression of SNX1 enhanced the proliferation and migration of CRC cells and was associated with the MACC1-MET pathway and EMT. SNX1 may serve as a potential biomarker for poor prognosis and a novel therapeutic target in CRC.

Key words: sorting nexin 1 (SNX1), colorectal cancer, cell migration, cell metastasis

CLC Number:

R735.3

QIAN Liheng, WEN Kailing, LIAO Yingna, LI Shuxin, NIE Huizhen. Study on the effect and mechanism of sorting nexin 1 on inhibiting the proliferation and migration of colorectal cancer cells[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1124-1135.

Figures/Tables 8

TrendMD

References 19

1	WADHWA V, PATEL N, GROVER D, et al. Interventional gastroenterology in oncology[J]. CA Cancer J Clin, 2023, 73(3): 286-319.
2	SIEGEL R L, MILLER K D, GODING SAUER A, et al. Colorectal cancer statistics, 2020[J]. CA Cancer J Clin, 2020, 70(3): 145-164.
3	VAN CUTSEM E, NORDLINGER B, ADAM R, et al. Towards a pan-European consensus on the treatment of patients with colorectal liver metastases[J]. Eur J Cancer, 2006, 42(14): 2212-2221.
4	QI Z, LAZAR C S, TRONCHÈRE H, et al. Endosomal localization and function of sorting nexin 1[J]. Proc Natl Acad Sci USA, 2002, 99(10): 6767-6772.
5	KURTEN R C, CADENA D L, GILL G N. Enhanced degradation of EGF receptors by a sorting nexin, SNX1[J]. Science, 1996, 272(5264): 1008-1010.
6	NISHIMURA Y, YOSHIOKA K, BERECZKY B, et al. Evidence for efficient phosphorylation of EGFR and rapid endocytosis of phosphorylated EGFR via the early/late endocytic pathway in a gefitinib-sensitive non-small cell lung cancer cell line[J]. Mol Cancer, 2008, 7: 42.
7	ZHAN X Y, ZHANG Y Q, ZHAI E T, et al. Sorting nexin-1 is a candidate tumor suppressor and potential prognostic marker in gastric cancer[J]. PeerJ, 2018, 6: e4829.
8	潘泓, 廖颖娜, 盖严支, 等. 分选链接蛋白1在胰腺导管腺癌中的表达及其促进胰腺导管腺癌进展的机制研究[J]. 上海交通大学学报(医学版), 2023, 43(3): 278-292.
	PAN H, LIAO Y N, GAI Y Z, et al. Expression of sorting nexin 1 in pancreatic ductal adenocarcinoma and its mechanism in promoting PDAC progress[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(3): 278-292.
9	HUANG Y H, HONG W Q, WEI X W. The molecular mechanisms and therapeutic strategies of EMT in tumor progression and metastasis[J]. J Hematol Oncol, 2022, 15(1): 129.
10	BILLER L H, SCHRAG D. Diagnosis and treatment of metastatic colorectal cancer: a review[J]. JAMA, 2021, 325(7): 669-685.
11	KAHI C J, BOLAND C R, DOMINITZ J A, et al. Colonoscopy surveillance after colorectal cancer resection: recommendations of the US multi-society task force on colorectal cancer[J]. Am J Gastroenterol, 2016, 111(3): 337-346; quiz 347.
12	GERSTBERGER S, JIANG Q W, GANESH K. Metastasis[J]. Cell, 2023, 186(8): 1564-1579.
13	ZHAO Y, LIU Y J, LIN L, et al. The lncRNA MACC1-AS1 promotes gastric cancer cell metabolic plasticity via AMPK/Lin28 mediated mRNA stability of MACC1[J]. Mol Cancer, 2018, 17(1): 69.
14	RADHAKRISHNAN H, WALTHER W, ZINCKE F, et al. MACC1: the first decade of a key metastasis molecule from gene discovery to clinical translation[J]. Cancer Metastasis Rev, 2018, 37(4): 805-820.
15	NISHIMURA Y, TAKIGUCHI S, ITO S, et al. Evidence that depletion of the sorting nexin 1 by siRNA promotes HGF-induced MET endocytosis and MET phosphorylation in a gefitinib-resistant human lung cancer cell line[J]. Int J Oncol, 2014, 44(2): 412-426.
16	YUAN X, WU H, HAN N, et al. Notch signaling and EMT in non-small cell lung cancer: biological significance and therapeutic application[J]. J Hematol Oncol, 2014, 7: 87.
17	WANG Y D, WU B R, FARRAR E, et al. Notch-Tnf signalling is required for development and homeostasis of arterial valves[J]. Eur Heart J, 2017, 38(9): 675-686.
18	KIM R K, KAUSHIK N, SUH Y, et al. Radiation driven epithelial-mesenchymal transition is mediated by Notch signaling in breast cancer[J]. Oncotarget, 2016, 7(33): 53430-53442.
19	ZAVADIL J, CERMAK L, SOTO-NIEVES N, et al. Integration of TGF-β/Smad and Jagged1/Notch signalling in epithelial-to-mesenchymal transition[J]. EMBO J, 2004, 23(5): 1155-1165.

siRNA	Forward (5′➝3′)	Reverse (5′➝3′)
NC-siRNA	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT
SNX1-siRNA1	GAGGAUCAAUUUGAUUUGATT	UCAAAUCAAAUUGAUCCUCTT
SNX1-siRNA2	CAGGCCAACAAUGACUUCUTT	AGAAGUCAUUGUUGGCCUGTT

siRNA	Forward (5′➝3′)	Reverse (5′➝3′)
NC-siRNA	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT
SNX1-siRNA1	GAGGAUCAAUUUGAUUUGATT	UCAAAUCAAAUUGAUCCUCTT
SNX1-siRNA2	CAGGCCAACAAUGACUUCUTT	AGAAGUCAUUGUUGGCCUGTT

Primer	Forward (5′➝3′)	Reverse (5′➝3′)
18s mRNA	TGCGAGTACTCAACACCAACA	GCATATCTTCGGCCCACA
SNX1	AAGCACTCTCAGAATGGCTTC	CGGCCCTCCGTTTTTCAAG
MACC1	GGGTCACAGGTGAACGAGAT	CTGGGTCCTGGCATTCTGTA
MET	ATTTTGCTTTGCCAGTGGTGG	AGCGATGTTGACATGCCACT
NOTCH1	AGAGGCGTGGCAGACTATG	CTGGCACGATTTCCCTGACC
CDH1	GGCTGGACCGAGAGAGTTTC	CGACGTTAGCCTCGTTCTCA
VIM	CTCCCTGAACCTGAGGGAAAC	TTGCGCTCCTGAAAAACTGC
SNAI1	TAGCGAGTGGTTCTTCTGCG	TGCTGGAAGGTAAACTCTGGA

Primer	Forward (5′➝3′)	Reverse (5′➝3′)
18s mRNA	TGCGAGTACTCAACACCAACA	GCATATCTTCGGCCCACA
SNX1	AAGCACTCTCAGAATGGCTTC	CGGCCCTCCGTTTTTCAAG
MACC1	GGGTCACAGGTGAACGAGAT	CTGGGTCCTGGCATTCTGTA
MET	ATTTTGCTTTGCCAGTGGTGG	AGCGATGTTGACATGCCACT
NOTCH1	AGAGGCGTGGCAGACTATG	CTGGCACGATTTCCCTGACC
CDH1	GGCTGGACCGAGAGAGTTTC	CGACGTTAGCCTCGTTCTCA
VIM	CTCCCTGAACCTGAGGGAAAC	TTGCGCTCCTGAAAAACTGC
SNAI1	TAGCGAGTGGTTCTTCTGCG	TGCTGGAAGGTAAACTCTGGA

[1]	JIANG Yi, HUANG Chenhao, LI Zhiliang, WU Junwei, ZHAO Ren, ZHANG Tao. Effect of preoperative chemotherapy combined with immunotherapy in a colorectal cancer patient with KRAS mutation [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(9): 1256-1260.
[2]	CHEN Jiaying, CHU Yimin, PENG Haixia. Study on prediction model and influencing factors of progression-free survival in colorectal cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(3): 324-334.
[3]	LIANG Lebin, CHEN Huifang, LAI Shujing, GU liang, SU Bing. Analysis of epigenetic characteristics in colonic tumors of Apc^min/+via spatial ATAC-seq technology [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(10): 1261-1270.
[4]	FENG Xujiao, LIU Jianyue, QI Yangyang, SUN Jing, SHEN Lei. Phenotype and function of NK cell in colorectal cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(6): 713-722.
[5]	YU Yang, MENG Dan, QIU Yiwen, YUAN Jian, ZHU Yingjie. Analysis of impact of type 1 diabetes on colorectal cancer by using two-sample Mendelian randomization [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(6): 755-761.
[6]	LI Huxiao, LI Xiaotian, ZHAO Xuri, ZHANG Huanyu, ZHOU Wei, SONG Zhongchen. Effects of gingipain extract on the biological characteristics of oral squamous cell carcinoma cell HN6 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(2): 161-168.
[7]	GAO Kexing, LIAO Chunhua, LI Shengze, MA Shuangyu, HUANG Lei. Functional site analysis of mucin 1 in regulating the malignant characteristics of tumor cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1370-1382.
[8]	LUO Chen, SHEN Ling, WANG Chuanwei, GU Jiani, WANG Jin, ZHAO Li, HUANG Shuai. Current status and influencing factors of early mobilization of patients undergoing laparoscopic radical resection of colorectal cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(9): 1201-1210.
[9]	PAN Hong, LIAO Yingna, GAI Yanzhi, QIAN Liheng, NIE Huizhen. Expression of sorting nexin 1 in pancreatic ductal adenocarcinoma and its mechanism in promoting PDAC progress [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(3): 278-292.
[10]	PENG Tian, XU Leiming. Crosstalk between epigenetic modification and circRNA in colorectal cancer: recent advances [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(2): 237-243.
[11]	TU Juanjuan, JIN Zhiming. Research progress of immune checkpoint inhibitors in the treatment of metastatic colorectal cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(2): 250-255.
[12]	TAI Rui, FANG Fang, MAO Jingjue, ZHOU Xia. Analysis of influencing factors of adaptation level in patients with permanent enterostomy [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(11): 1423-1429.
[13]	HU Muni, JI Linhua, ZHANG Xinyu, SHEN Chaoqin, HONG Jie, CHEN Haoyan. Association analysis of T cell receptor repertoire diversity with clinical characteristics and Fusobacterium nucleatum abundance in colorectal cancer patients [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(8): 1045-1052.
[14]	QIU Jiahui, CAI Qianqian, YANG Yan, CHENG Feichi, QIU Zhengjun, HUANG Chen. Value of combined perineural lymphovascular invasion and tumor-stroma ratio in guiding the prognosis of colorecatal cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(8): 1070-1080.
[15]	LIU Ziyang, WANG Xiaowen, CHEN Li. lncRNA GK-IT1 influences the carcinogenesis of non-small cell lung cancer cells through regulating aldolase A [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 591-601.