LINC01123 promotes proliferation and glycolysis of gastric cancer via binding to ENO1

doi:10.3969/j.issn.1674-8115.2025.11.004

Abstract

Abstract:

Objective ·To investigate the expression and tumor-promoting mechanism of the long non-coding RNA (lncRNA) LINC01123 in gastric cancer and evaluate its potential as a novel diagnostic biomarker and therapeutic target. Methods ·Differential expression analysis of lncRNAs between gastric cancer and normal tissues was performed based on The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) datasets (GSE95667, GSE99416) by using R software. LINC01123 was identified as the candidate of interest. Its expression was validated in gastric cancer cell lines and clinical tissue samples by using qRT-PCR. The biological effects of LINC01123 on cell proliferation and metastasis were evaluated in vitro through gene overexpression and knockdown by utilizing CCK-8, colony formation, wound healing, and Transwell migration and invasion assays. In vivo, a subcutaneous xenograft tumor model in nude mice was established to assess the effect of LINC01123 on tumor growth. ATP and lactate production were measured to evaluate the role of LINC01123 in glycolysis. Transcriptome sequencing and Gene Set Enrichment Analysis (GSEA) were conducted to explore related pathways. RNA pull-down combined with mass spectrometry was used to identify proteins interacting with LINC01123. The binding region was predicted using the catRAPID database and validated by constructing α-enolase (ENO1) protein truncation mutants and performing RNA immunoprecipitation (RIP) assays. Functional interaction studies were carried out to determine whether ENO1 mediates the oncogenic effect of LINC01123. Results ·LINC01123 was upregulated in gastric cancer tissues and cell lines and was associated with poor patient prognosis (P=0.021). Functional assays demonstrated that LINC01123 promoted proliferation, migration, invasion, and glycolysis of gastric cancer cells such as MKN-45 in vitro, and enhanced tumor growth in vivo (all P<0.05). Mechanistically, LINC01123 was predominantly localized in the cytoplasm and bound to the 97‒237 amino acid region of ENO1 protein. Further studies showed that ENO1 knockdown in LINC01123-overexpressing cells partially reversed the proliferative and migratory effects of LINC01123 (all P<0.05) , indicating that ENO1 upregulation enhances the tumor-promoting function of LINC01123. Conclusion ·LINC01123 is highly expressed in gastric cancer and promotes tumor progression by binding to ENO1 protein and enhancing proliferation, migration, invasion, and glycolysis. LINC01123 holds promise as a novel diagnostic and prognostic biomarker and a potential therapeutic target for gastric cancer.

Key words: LINC01123, gastric cancer, α-enolase, long non-coding RNA, proliferation

CLC Number:

R735.2

ZHANG Shuqiong, KE Xing, ZHAO Xinghe, CHEN Xiaocui, ZHENG Haodong, CHEN Hui, SHEN Lisong, YANG Junyao. LINC01123 promotes proliferation and glycolysis of gastric cancer via binding to ENO1[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(11): 1443-1457.

Figures/Tables 9

Tab 1 Knockdown sequences for lentiviral vector construction

Gene	Sequence (5′→3′)
si-LINC01123
Sense	TTCTCTTTATTTTTATACAGT
Antisense	ACTGTATAAAAATAAAGAGAA
si-ENO1
Sense	CCCAGUGGUGUCUAUCGAATT
Antisense	UUCGAUAGACACCACUGGGTT
si-NC
Sense	UUCUCCGAACGUGUCACGU
Antisense	ACGUGACACGUUCGGAGAA
sh-LINC01123	CCGGTTCTCTTTATTTTTATACAGTCTCGAGACTGTATAAAAATAAAGAGAATTTTTG
sh-NC	TTCTCCGAACGTGTCACGT

Tab 2 Primers sequences for qRT-PCR

Gene	Sequence (5′→3′)
LINC01123
Forward	ACAGTGGCCGCACGCATAGCTG
Reverse	CTGACGACCGAGGTGACAACGATGA
ENO1
Forward	GCCTCCTGCTCAAAGTCAAC
Reverse	AACGATGAGACACCATGACG
GAPDH
Forward	TTGGTATCGTGGAAGGACTCA
Reverse	TGTCATCATATTTGGCAGGTTT
U6
Forward	CGCTTCGGCAGCACATATAC
Reverse	TTCACGAATTTGCGTGTCATC

Fig 1 Overexpression of LINC01123 in gastric cancer and its association with poor prognosis

Fig 2 Inhibitory effects of LINC01123 knockdown on gastric cancer cell proliferation, migration, and invasion in vitro

Fig 3 Promotive effects of LINC01123 overexpression on gastric cancer cell proliferation, migration, and invasion in vitro

Fig 4 Regulatory role of LINC01123 in EMT and PI3K/AKT pathway

Fig 5 Promotion of tumorigenesis of gastric cancer MKN-45 cells by LINC01123 in vivo

Fig 6 Binding of LINC01123 to ENO1 protein and regulation of glycolysis in gastric cancer cells by LINC01123

Fig 7 Promotion of proliferation, migration, invasion, and glycolysis by LINC01123 via ENO1

TrendMD

References 26

[1]	ARNOLD M, PARK J Y, CAMARGO M C, et al. Is gastric cancer becoming a rare disease? A global assessment of predicted incidence trends to 2035[J]. Gut, 2020, 69(5): 823-829.
[2]	KIM H, HWANG Y, SUNG H, et al. Effectiveness of gastric cancer screening on gastric cancer incidence and mortality in a community-based prospective cohort[J]. Cancer Res Treat, 2018, 50(2): 582-589.
[3]	SIEGEL R L, MILLER K D, WAGLE N S, et al. Cancer statistics, 2023[J]. CA A Cancer J Clinicians, 2023, 73(1): 17-48.
[4]	SUNG H, FERLAY J, SIEGEL R L, et al. Global cancer statistics 2020: globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2021, 71(3): 209-249.
[5]	PICARD M. Why do we care more about disease than health?[J]. Phenomics, 2022, 2(3): 145-155.
[6]	GUTSCHNER T, DIEDERICHS S. The hallmarks of cancer: a long non-coding RNA point of view[J]. RNA Biol, 2012, 9(6): 703-719.
[7]	DE LOS SANTOS M C, DRAGOMIR M P, CALIN G A. The role of exosomal long non-coding RNAs in cancer drug resistance[J]. Cancer Drug Resist, 2019, 2(4): 1178-1192.
[8]	ZHAO J, XU H, SU Y H, et al. Emerging regulatory mechanisms of N⁶-methyladenosine modification in cancer metastasis[J]. Phenomics, 2023, 3(1): 83-100.
[9]	HUA Q, JIN M M, MI B M, et al. LINC01123, a c-Myc-activated long non-coding RNA, promotes proliferation and aerobic glycolysis of non-small cell lung cancer through miR-199a-5p/c-Myc axis[J]. J Hematol Oncol, 2019, 12(1): 91.
[10]	SHANG T, ZHOU X, CHEN W. LINC01123 promotes the progression of colorectal cancer via miR-625-5p/LASP1 axis[J]. Cancer Biother Radiopharm, 2021, 36(9): 765-773.
[11]	XIAO Z Q, LIU Y, ZHAO J J, et al. Long noncoding RNA LINC01123 promotes the proliferation and invasion of hepatocellular carcinoma cells by modulating the miR-34a-5p/TUFT1 axis[J]. Int J Biol Sci, 2020, 16(13): 2296-2305.
[12]	YANG Y, ZHENG Y, ZHANG H L, et al. An immune-related gene panel for preoperative lymph node status evaluation in advanced gastric cancer[J]. Biomed Res Int, 2020, 2020: 8450656.
[13]	YE S C, SUN B L, WU W Y, et al. LINC01123 facilitates proliferation, invasion and chemoresistance of colon cancer cells[J]. Biosci Rep, 2020, 40(8): BSR20194062.
[14]	ZHANG M, HAN Y G, ZHENG Y, et al. ZEB1-activated LINC01123 accelerates the malignancy in lung adenocarcinoma through NOTCH signaling pathway[J]. Cell Death Dis, 2020, 11(11): 981.
[15]	ZHANG P R, LONG Q M, ZENG S Y, et al. FOXC1-induced LINC01123 acts as a mediator in triple negative breast cancer[J]. Cancer Cell Int, 2020, 20: 199.
[16]	SUGAHARA T, NAKAJIMA H, SHIRAHATA S, et al. Purification and characterization of immunoglobulin production stimulating factor-II beta derived from Namalwa cells[J]. Cytotechnology, 1992, 10(2): 137-146.
[17]	HUANG H, TANG S, JI M, et al. p300-mediated lysine 2-hydroxyisobutyrylation regulates glycolysis[J]. Mol Cell, 2018, 70(4): 663-678.e6.
[18]	LÓPEZ-ALEMANY R, LONGSTAFF C, HAWLEY S, et al. Inhibition of cell surface mediated plasminogen activation by a monoclonal antibody against α-enolase[J]. Am J Hematol, 2003, 72(4): 234-242.
[19]	HUA Q, WANG D L, ZHAO L, et al. AL355338 acts as an oncogenic lncRNA by interacting with protein ENO1 to regulate EGFR/AKT pathway in NSCLC[J]. Cancer Cell Int, 2021, 21(1): 525.
[20]	YU S M, LI N, HUANG Z B, et al. A novel lncRNA, TCONS_00006195, represses hepatocellular carcinoma progression by inhibiting enzymatic activity of ENO1[J]. Cell Death Dis, 2018, 9(12): 1184.
[21]	BARLEBO AHLBORN L, ØSTRUP O. Toward liquid biopsies in cancer treatment: application of circulating tumor DNA[J]. APMIS, 2019, 127(5): 329-336.
[22]	TRUJANO-CAMACHO S, CANTÚ-DE LEÓN D, PÉREZ-YEPEZ E, et al. HOTAIR promotes the hyperactivation of PI3K/Akt and Wnt/β-catenin signaling pathways via PTEN hypermethylation in cervical cancer[J]. Cells, 2024, 13(17): 1484.
[23]	HU Y R, YU Y C, YOU S W, et al. Long noncoding RNA MALAT1 regulates autophagy associated chemoresistance via miR-23b-3p sequestration in gastric cancer[J]. Mol Cancer, 2017, 16(1): 174.
[24]	LI H, MA X H, YANG D S, et al. PCAT-1 contributes to cisplatin resistance in gastric cancer through epigenetically silencing PTEN via recruiting EZH2[J]. J Cell Biochem, 2020, 121(2): 1353-1361.
[25]	GUO Y M, YUE P R, WANG Y M, et al. PCAT-1 contributes to cisplatin resistance in gastric cancer through miR-128/ZEB1 axis[J]. Biomed Pharmacother, 2019, 118: 109255.
[26]	RAY R, MILLER D M. Cloning and characterization of a human c-myc promoter-binding protein[J]. Mol Cell Biol, 1991, 11(4): 2154-2161.