Effects of extracellular vesicles derived from Lactobacillus rhamnosus GG on the biological properties of MC3T3-E1 cells

doi:10.3969/j.issn.1674-8115.2026.09.004

Abstract

Abstract:

Objective ·To observe the effects of extracellular vesicles derived from Lactobacillus rhamnosus GG (L.GG-EVs) on the proliferation, migration, and osteogenic differentiation of mouse embryonic osteoblast precursor cell line (MC3T3-E1). Methods ·After L.GG-EVs were extracted by ultracentrifugation, the morphology of L.GG-EVs was observed by transmission electron microscope (TEM), and the particle size distribution of L.GG-EVs was measured by ZETAView nanoparticle size tracker. After SDS-PAGE, Coomassie brilliant blue R-250 staining was used to observe the protein expression of L.GG-EVs. The effect of L.GG-EVs(12.5, 25, 50, and 100 μg/mL) on the viability of MC3T3-E1 cells after 1, 3, 5, and 7 d of co-culture was evaluated by a cell counting kit-8 (CCK-8) assay. The wound-healing assay was used to detect the effect of L.GG-EVs (50 and 100 μg/mL) on the migration ability of MC3T3-E1 cells after 6 and 24 h of co-culture. Alkaline phosphatase (ALP) staining was used to detect the effect of L.GG-EVs (50 and 100 μg/mL) on the ALP expression in MC3T3-E1 cells following 7 d of co-culture. Alizarin red S staining was used to detect the effect of L.GG-EVs (50 and 100 μg/mL) on calcium nodule formation in MC3T3-E1 cells after 21 d of co-culture. Quantitative real-time PCR (qPCR) was used to detect the mRNA expression of osteogenic genes, including Runt-related transcription factor 2 (Runx2), osteopontin (Opn), and bone morphogenetic protein 2 (Bmp2), in MC3T3-E1 cells after 7 d of co-culture with L.GG-EVs (50 and 100 μg/mL). A rat alveolar bone defect model was constructed and divided into the surgical group (SUR group), the pure hydrogel group [gelatin methacryloyl (GelMA) group], and the hydrogel group loaded with L.GG-EVs (GelMA-L.GG-EVs group). The alveolar bone regeneration was detected by Micro-CT. Results ·L.GG-EVs were spherical, double-layered membrane vesicles, with diameters ranging from 20 to 500 nm and an average diameter of approximately 161 nm, showing a normal distribution. A protein band was observed at a relative molecular mass of 42 000. CCK-8 assay showed that compared with the CON group, L.GG-EVs at 50 and 100 μg/mL significantly promoted the proliferation of MC3T3-E1 cells after co-culture for 3, 5, and 7 d (all P<0.05). The wound-healing assay indicated that L.GG-EVs (50 and 100 μg/mL) accelerated the migration of MC3T3-E1 cells compared with the Ctrl group (all P<0.05). After 7 d of co-culture, L.GG-EVs (50 and 100 μg/mL) markedly intensified ALP staining in MC3T3-E1 cells (both P<0.05). After 21 d of co-culture, L.GG-EVs (50 and 100 μg/mL) significantly increased calcium nodule formation in MC3T3-E1 cells (both P=0.001). After 7 d of co-culture, 50 μg/mL L.GG-EVs up-regulated the expression of Opn and Bmp2 mRNA (both P<0.05), and 100 μg/mL L.GG-EVs up-regulated the expression of Runx2, Opn, and Bmp2 mRNA (all P<0.05). In the rat alveolar bone defect model, L.GG-EVs significantly promoted alveolar bone regeneration (all P<0.05). Conclusion ·L.GG-EVs can promote the proliferation, migration, and osteogenic differentiation of MC3T3-E1 cells, and have the potential to facilitate bone tissue regeneration.

Key words: Lactobacillus rhamnosus GG (L.GG), extracellular vesicle (EV), mouse embryonic osteoblast precursor cell line (MC3T3-E1), proliferation, migration, osteogenic differentiation

CLC Number:

R781.4

Ye Zhiyun, Zhou Yining, Chen Huiwen, He Zhiyan, Zhou Wei, Song Zhongchen. Effects of extracellular vesicles derived from Lactobacillus rhamnosus GG on the biological properties of MC3T3-E1 cells[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026,(9): 1188-1198.

Figures/Tables 8

Tab 1 Primer sequences for qPCR

Gene	Forward sequence (5′→3′)	Reverse sequence (5′→3′)
Runx2	CCGGGAATGATGAGAACTA	ACCGTCCACTGTCACTTT
Opn	AGCAAGAAACTCTTCCAAGCAA	GTGAGATTCGTCAGATTCATCCG
Bmp2	ATGTGAGGATTAGCAGGTCTTTG	TGGTTAGTGGAGTTCAGGTGGT
β-actin	GTGACGTTGACATCCGTAAAGA	GCCGGACTCATCGTACTC

Fig 1 Characterization of L.GG-EVs

Fig 2 Effects of different concentrations of L.GG-EVs on the proliferation of MC3T3-E1 after 1 d (A), 3 d (B), 5 d (C), and 7 d (D) of co-culture

Fig 3 Effects of 50 and 100 μg/mL L.GG-EVs on the migration of MC3T3-E1 at different time points after co-culture

Fig 4 Effects of L.GG-EVs on the expression of ALP in MC3T3-E1 after 7 d of co-culture

Fig 5 Effects of L.GG-EVs on calcium nodule formation in MC3T3-E1 after 21 d of co-culture

Fig 6 Effects of L.GG-EVs on the expression of osteogenic markers in MC3T3-E1 after 7 d of co-culture

Fig 7 Effects of L.GG-EVs on alveolar bone regeneration in a rat alveolar bone defect model

TrendMD

References 27

[1]	Baker J L, Mark Welch J L, Kauffman K M, et al. The oral microbiome: diversity, biogeography and human health[J]. Nat Rev Microbiol, 2024, 22(2): 89-104.
[2]	Defta C L, Albu C C, Albu Ş D, et al. Oral mycobiota: a narrative review[J]. Dent J, 2024, 12(4): 115.
[3]	van Holm W, Carvalho R, Delanghe L, et al. Antimicrobial potential of known and novel probiotics on in vitro periodontitis biofilms[J]. NPJ Biofilms Microbiomes, 2023, 9(1): 3.
[4]	Homayouni Rad A, Pourjafar H, Mirzakhani E. A comprehensive review of the application of probiotics and postbiotics in oral health[J]. Front Cell Infect Microbiol, 2023, 13: 1120995.
[5]	Mahdizade Ari M, Mirkalantari S, Darban-Sarokhalil D, et al. Investigating the antimicrobial and anti-inflammatory effects of Lactobacillus and Bifidobacterium spp. on cariogenic and periodontitis pathogens[J]. Front Microbiol, 2024, 15: 1383959.
[6]	Laleman I, Pauwels M, Quirynen M, et al. A dual-strain Lactobacilli reuteri probiotic improves the treatment of residual pockets: a randomized controlled clinical trial[J]. J Clin Periodontol, 2020, 47(1): 43-53.
[7]	Invernici M M, Salvador S L, Silva P H F, et al. Effects of Bifidobacterium probiotic on the treatment of chronic periodontitis: a randomized clinical trial[J]. J Clin Periodontol, 2018, 45(10): 1198-1210.
[8]	Mendonça C D, Mata A D S P D, Azevedo L F R, et al. Probiotics in the non-surgical treatment of periodontitis: a systematic review and network meta-analysis[J]. BMC Oral Health, 2024, 24(1): 1224.
[9]	Capurso L. Thirty years of Lactobacillus rhamnosus GG: a review[J]. J Clin Gastroenterol, 2019, 53(Suppl 1): S1-S41.
[10]	Silva D N A, Cruz N T S, Martins A A, et al. Probiotic Lactobacillus rhamnosus EM1107 prevents hyperglycemia, alveolar bone loss, and inflammation in a rat model of diabetes and periodontitis[J]. J Periodontol, 2023, 94(3): 376-388.
[11]	Gatej S M, Marino V, Bright R, et al. Probiotic Lactobacillus rhamnosus GG prevents alveolar bone loss in a mouse model of experimental periodontitis[J]. J Clin Periodontol, 2018, 45(2): 204-212.
[12]	Xie J H, Li Q Q, Haesebrouck F, et al. The tremendous biomedical potential of bacterial extracellular vesicles[J]. Trends Biotechnol, 2022, 40(10): 1173-1194.
[13]	Krzyżek P, Marinacci B, Vitale I, et al. Extracellular vesicles of probiotics: shedding light on the biological activity and future applications[J]. Pharmaceutics, 2023, 15(2): 522.
[14]	Tong L J, Zhang X Y, Hao H N, et al. Lactobacillus rhamnosus GG derived extracellular vesicles modulate gut microbiota and attenuate inflammatory in DSS-induced colitis mice[J]. Nutrients, 2021, 13(10): 3319.
[15]	Wang J, Li X J, Zhao X Y, et al. Lactobacillus rhamnosus GG-derived extracellular vesicles promote wound healing via miR-21-5p-mediated re-epithelization and angiogenesis[J]. J Nanobiotechnology, 2024, 22(1): 644.
[16]	Zhang X M, Wang Y, E Q, et al. The biological activity and potential of probiotics-derived extracellular vesicles as postbiotics in modulating microbiota-host communication[J]. J Nanobiotechnology, 2025, 23(1): 349.
[17]	Wei J T, Li Z H, Fan Y, et al. Lactobacillus rhamnosus GG aggravates vascular calcification in chronic kidney disease: a potential role for extracellular vesicles[J]. Life Sci, 2023, 331: 122001.
[18]	Sawant H, Bihl J, Borthakur A. A simplified method for the isolation of extracellular vesicles from probiotic bacteria and their characterization[J]. Int J Mol Sci, 2025, 26(3): 1058.
[19]	Gomez-Puerto M C, Iyengar P V, García de Vinuesa A, et al. Bone morphogenetic protein receptor signal transduction in human disease[J]. J Pathol, 2019, 247(1): 9-20.
[20]	He H P, Li D C, Huang J M, et al. AS2863619 boosts osteogenesis in periodontal ligament stem cells and mitigates inflammatory impairment[J]. Int Immunopharmacol, 2025, 161: 115101.
[21]	Cheng G P, Guo S J, Li M X, et al. Hydroxyapatite-coated small intestinal submucosa membranes enhanced periodontal tissue regeneration through immunomodulation and osteogenesis via BMP-2/Smad signaling pathway[J]. Adv Healthc Mater, 2024, 13(3): e2301479.
[22]	Gomathi K, Akshaya N, Srinaath N, et al. Regulation of Runx2 by post-translational modifications in osteoblast differentiation[J]. Life Sci, 2020, 245: 117389.
[23]	Si J Y, Wang C W, Zhang D H, et al. Osteopontin in bone metabolism and bone diseases[J]. Med Sci Monit, 2020, 26: e919159.
[24]	Li S Y, Yue Y, Wang W Q, et al. Ultrasound-activated probiotics vesicles coating for titanium implant infections through bacterial cuproptosis-like death and immunoregulation[J]. Adv Mater, 2024, 36(44): e2405953.
[25]	Kong X X, Liu H, Chen S M, et al. Bioengineered bacterial extracellular vesicles for targeted delivery of an osteoclastogenesis-inhibitory peptide to alleviate osteoporosis[J]. J Control Release, 2025, 382: 113751.
[26]	Li S, Sheng Y Y, You Y, et al. Study on VEGFA mRNA delivery via GelMA hydrogel-encapsulated extracellular vesicles for enhanced bone regeneration[J]. Mater Today Bio, 2025, 34: 102144.
[27]	Han N N, Li X Y, Du J, et al. The impacts of oral and gut microbiota on alveolar bone loss in periodontitis[J]. J Periodontal Res, 2023, 58(6): 1139-1147.