Journal of Shanghai Jiao Tong University (Medical Science) ›› 2022, Vol. 42 ›› Issue (4): 422-432.doi: 10.3969/j.issn.1674-8115.2022.04.004
• High-risk pregnancy column • Previous Articles Next Articles
WU Xiafei1(), FANG Jie1, QI Hongbo1,2, YU Xinyang1()
Received:
2021-12-01
Accepted:
2022-03-16
Online:
2022-04-28
Published:
2022-04-28
Contact:
YU Xinyang
E-mail:cq_wxf@163.com;yu_xinyoung@163.com
Supported by:
CLC Number:
WU Xiafei, FANG Jie, QI Hongbo, YU Xinyang. Neuropsychiatric effects of gestational diabetes mellitus in adult offspring in C57BL/6J mice[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(4): 422-432.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2022.04.004
Gene | Forward primer | Reverse primer |
---|---|---|
β-actin | CACTGTCGAGTCGCGTCC | TCATCCATGGCGAACTGGTG |
Drd1 | AGGTTGAGCAGGACATACGC | TTGCTTCTGGGCAATCCTGT |
Htr2a | CTGATTCCTCTCTGTGCGCT | TCCAGCACGGTTGAAGTCTG |
Bdnf | TAAACGTCCACGGACAAGGC | TCGTCAGACCTCTCGAACCT |
Creb1 | GAAGAGACTTCTGCCCTCCG | GAAGAGACTTCTGCCCTCCC |
Tab 1 Primer sequence for RT-qPCR(5′→3′)
Gene | Forward primer | Reverse primer |
---|---|---|
β-actin | CACTGTCGAGTCGCGTCC | TCATCCATGGCGAACTGGTG |
Drd1 | AGGTTGAGCAGGACATACGC | TTGCTTCTGGGCAATCCTGT |
Htr2a | CTGATTCCTCTCTGTGCGCT | TCCAGCACGGTTGAAGTCTG |
Bdnf | TAAACGTCCACGGACAAGGC | TCGTCAGACCTCTCGAACCT |
Creb1 | GAAGAGACTTCTGCCCTCCG | GAAGAGACTTCTGCCCTCCC |
1 | 魏玉梅, 杨慧霞. 我国妊娠期糖尿病研究的发展与展望[J]. 中华围产医学杂志, 2018, 21(4): 218-220. |
WEI Y M, YANG H X. Development and prospect of research on gestational diabetes mellitus in China[J]. Chin J Perinat Med, 2018, 21(4): 218-220. | |
2 | BOLTON J L, BILBO S D. Developmental programming of brain and behavior by perinatal diet: focus on inflammatory mechanisms[J]. Dialogues Clin Neurosci, 2014, 16(3): 307-320. |
3 | SOUSA R, TORRES Y S, FIGUEIREDO C P, et al. Consequences of gestational diabetes to the brain and behavior of the offspring[J]. An Acad Bras Cienc, 2018, 90(2 suppl 1): 2279-2291. |
4 | GAWLIŃSKA K, GAWLIŃSKI D, KOROSTYŃSKI M, et al. Maternal dietary patterns are associated with susceptibility to a depressive-like phenotype in rat offspring[J]. Dev Cogn Neurosci, 2021, 47: 100879. |
5 | FARAHVAR S, WALFISCH A, SHEINER E. Gestational diabetes risk factors and long-term consequences for both mother and offspring: a literature review[J]. Expert Rev Endocrinol Metab, 2019, 14(1): 63-74. |
6 | NOMURA Y, MARKS D J, GROSSMAN B, et al. Exposure to gestational diabetes mellitus and low socioeconomic status: effects on neurocognitive development and risk of attention-deficit/hyperactivity disorder in offspring[J]. Arch Pediatr Adolesc Med, 2012, 166(4): 337-343. |
7 | 王晓瑜, 朱岷, 程昕然. 妊娠糖尿病对子代神经发育的研究进展[J]. 四川医学, 2020, 41(10): 1083-1089. |
WANG X Y, ZHU M, CHENG X R. Research progress of gestational diabetes mellitus on offspring neurodevelopment[J]. Sichuan Med J, 2020, 41(10): 1083-1089. | |
8 | VAN LIESHOUT R J, VORUGANTI L P. Diabetes mellitus during pregnancy and increased risk of schizophrenia in offspring: a review of the evidence and putative mechanisms[J]. J Psychiatry Neurosci, 2008, 33(5): 395-404. |
9 | VUONG B, ODERO G, ROZBACHER S, et al. Exposure to gestational diabetes mellitus induces neuroinflammation, derangement of hippocampal neurons, and cognitive changes in rat offspring[J]. J Neuroinflammation, 2017, 14(1): 80. |
10 | BORA E, HARRISON B J, DAVEY C G, et al. Meta-analysis of volumetric abnormalities in cortico-striatal-pallidal-thalamic circuits in major depressive disorder[J]. Psychol Med, 2012, 42(4): 671-681. |
11 | HAYASAKA S, NAKAMURA M, NODA Y, et al. Lateralized hippocampal volume increase following high-frequency left prefrontal repetitive transcranial magnetic stimulation in patients with major depression[J]. Psychiatry Clin Neurosci, 2017, 71(11): 747-758. |
12 | SEXTON C E, MACKAY C E, EBMEIER K P. A systematic review and meta-analysis of magnetic resonance imaging studies in late-life depression[J]. Am J Geriatr Psychiatry, 2013, 21(2): 184-195. |
13 | DABELEA D, KNOWLER W C, PETTITT D J. Effect of diabetes in pregnancy on offspring: follow-up research in the Pima Indians[J]. J Matern Fetal Med, 2000, 9(1): 83-88. |
14 | LAWLOR D A, LICHTENSTEIN P, LÅNGSTRÖM N. Association of maternal diabetes mellitus in pregnancy with offspring adiposity into early adulthood: sibling study in a prospective cohort of 280,866 men from 248,293 families[J]. Circulation, 2011, 123(3): 258-265. |
15 | CANNON M, JONES P B, MURRAY R M. Obstetric complications and schizophrenia: historical and meta-analytic review[J]. Am J Psychiatry, 2002, 159(7): 1080-1092. |
16 | PANARIELLO F, FANELLI G, FABBRI C, et al. Epigenetic basis of psychiatric disorders: a narrative review[J]. CNS Neurol Disord Drug Targets, 2022, 21(4): 302-315. |
17 | KONG L H, CHEN X X, GISSLER M, et al. Relationship of prenatal maternal obesity and diabetes to offspring neurodevelopmental and psychiatric disorders: a narrative review[J]. Int J Obes (Lond), 2020, 44(10): 1981-2000. |
18 | JING Y H, SONG Y F, YAO Y M, et al. Retardation of fetal dendritic development induced by gestational hyperglycemia is associated with brain insulin/IGF-I signals[J]. Int J Dev Neurosci, 2014, 37: 15-20. |
19 | RIVERA H M, CHRISTIANSEN K J, SULLIVAN E L. The role of maternal obesity in the risk of neuropsychiatric disorders[J]. Front Neurosci, 2015, 9: 194. |
20 | PIAZZA F V, SEGABINAZI E, DE MEIRELES A L F, et al. Severe uncontrolled maternal hyperglycemia induces microsomia and neurodevelopment delay accompanied by apoptosis, cellular survival, and neuroinflammatory deregulation in rat offspring hippocampus[J]. Cell Mol Neurobiol, 2019, 39(3): 401-414. |
21 | KONG L H, NORSTEDT G, SCHALLING M, et al. The risk of offspring psychiatric disorders in the setting of maternal obesity and diabetes[J]. Pediatrics, 2018, 142(3): e20180776. |
22 | ORNOY A. Growth and neurodevelopmental outcome of children born to mothers with pregestational and gestational diabetes[J]. Pediatr Endocrinol Rev, 2005, 3(2): 104-113. |
23 | XIANG A H, WANG X H, MARTINEZ MP, et al. Maternal gestational diabetes mellitus, type 1 diabetes, and type 2 diabetes during pregnancy and risk of ADHD in offspring[J]. Diabetes Care, 2018, 41(12): 2502-2508. |
24 | VAN LIESHOUT R J, VORUGANTI L P. Diabetes mellitus during pregnancy and increased risk of schizophrenia in offspring: a review of the evidence and putative mechanisms[J]. J Psychiatry Neurosci, 2008, 33(5): 395-404. |
25 | RAMANATHAN M, JAISWAL A K, BHATTACHARYA S K. Hyperglycaemia in pregnancy: effects on the offspring behaviour with special reference to anxiety paradigms[J]. Indian J Exp Biol, 2000, 38(3): 231-236. |
26 | PENNA E, PIZZELLA A, CIMMINO F, et al. Neurodevelopmental disorders: effect of high-fat diet on synaptic plasticity and mitochondrial functions[J]. Brain Sci, 2020, 10(11): 805. |
27 | HASEBE K, KENDIG M D, MORRIS M J. Mechanisms underlying the cognitive and behavioural effects of maternal obesity[J]. Nutrients, 2021, 13(1): 240. |
28 | KINNEY B A, RABE M B, JENSEN R A, et al. Maternal hyperglycemia leads to gender-dependent deficits in learning and memory in offspring[J]. Exp Biol Med (Maywood), 2003, 228(2): 152-159. |
29 | HUERTA-CERVANTES M, PEÑA-MONTES D J, MONTOYA-PÉREZ R, et al. Gestational diabetes triggers oxidative stress in hippocampus and cerebral cortex and cognitive behavior modifications in rat offspring: age- and sex-dependent effects[J]. Nutrients, 2020, 12(2): 376. |
30 | THION M S, LOW D, SILVIN A, et al. Microbiome influences prenatal and adult microglia in a sex-specific manner[J]. Cell, 2018, 172(3): 500-516.e16. |
31 | SALES V M, FERGUSON-SMITH A C, PATTI M E. Epigenetic mechanisms of transmission of metabolic disease across generations[J]. Cell Metab, 2017, 25(3): 559-571. |
32 | PINNEY S E, SIMMONS R A. Metabolic programming, epigenetics, and gestational diabetes mellitus[J]. Curr Diab Rep, 2012, 12(1): 67-74. |
33 | HUERTA-CERVANTES M, PEÑA-MONTES D J, LÓPEZ-VÁZQUEZ M Á, et al. Effects of gestational diabetes in cognitive behavior, oxidative stress and metabolism on the second-generation off-spring of rats[J]. Nutrients, 2021, 13(5): 1575. |
34 | ROOZENDAAL B, HAHN E L, NATHAN S V, et al. Glucocorticoid effects on memory retrieval require concurrent noradrenergic activity in the hippocampus and basolateral amygdala[J]. J Neurosci, 2004, 24(37): 8161-8169. |
35 | BORA E, FORNITO A, PANTELIS C, et al. Gray matter abnormalities in major depressive disorder: a meta-analysis of voxel based morphometry studies[J]. J Affect Disord, 2012, 138(1/2): 9-18. |
36 | MENARD C, PFAU M L, HODES G E, et al. Social stress induces neurovascular pathology promoting depression[J]. Nat Neurosci, 2017, 20(12): 1752-1760. |
37 | HARRISON P J. The neuropathology of primary mood disorder[J]. Brain, 2002, 125(Pt 7): 1428-1449. |
[1] | Qin GU, Yingqian XIA, Yiqing ZHU, Liying MA, Lei QU, Wenguang SUN. Analysis of the effects of individualized one-day outpatient diet guidance on glycemic control, body weight gain rate and pregnancy outcome in pregnant women with gestational diabetes mellitus [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(2): 185-191. |
[2] | Dan WU, Li-ping GE. Research progress of DNA methylation in gestational diabetes mellitus [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 1120-1124. |
[3] | Ning-xin QIN, Wen-long ZHAO, Zhi-yang ZHOU, Wei-hui SHI, Yan-ting WU, He-feng HUANG. Short- and long-term effects of frozen-thawed embryo transfer on offspring [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(5): 653-658. |
[4] | Yue-hua TU, Xiao-jin WANG, Bing-shun WANG. Effects of individualized nutritional standard meal intervention on the prevention of gestational diabetes in overweight and obese pregnant women [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(3): 360-365. |
[5] | Qing LIU, Wen CAI, Rui-qing ZHANG, Cong LU, Jia-rong ZHANG, Xian-ming XU. Value of pregnancy lipid tolerance test in predicting risk of gestational diabetes mellitus [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(2): 210-216. |
[6] | Ya-jie ZHU, Hui LIN, Xi CHEN, Yi-ran ZHAO, Xin-mei LIU, He-feng HUANG. Change of cortisol level in umbilical cord blood of neonates delivered by gestational diabetes mellitus mothers and its influence on offspring health [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(1): 49-54. |
[7] | ZHANG Yi-jing1, 2, XU Jian1, 2. Effect of maternal vitamin A deficiency during pregnancy on neurodevelopment of offspring [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(9): 1277-1282. |
[8] | CUI Hui-ru, LI Wei, PANG Jiao-yan, LI Hui, LI Chun-bo. Level of intolerance of uncertainty and related factors in patients with anxiety disorders [J]. , 2020, 40(3): 346-. |
[9] | GUO Yan-yan, GUO Fei, LI Tong, LI Yu-chen, HUANG He-feng, LIU Xin-mei. Changes and significance of coagulation indexes in pregnant women with gestational diabetes mellitus [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(12): 1614-1617. |
[10] | WU Ke1, SUN Han-xiao2, CAI Mei-qin1. Research progress of effect of carotenoids on maternal and child health [J]. , 2019, 39(8): 929-. |
[11] | YE Hua-ying1, 2, LI Hua-ping2. Correlation analysis of plasma lipid with glucose status and insulin resistance in pregnant women with gestational diabetes mellitus [J]. , 2019, 39(7): 768-. |
[12] | WANG Lei-lei1, TAO Ye-xuan2. Differences of intestinal flora between gestational diabetes mellitus pregnant women and healthy pregnant women [J]. , 2019, 39(11): 1300-. |
[13] | GU Ting-ting, LAI Dong-mei. Research progress on the correlation between gut microbiota and obstetrics and gynecology diseases [J]. , 2018, 38(8): 967-. |
[14] | WANG Yin-yu1, LIU Ye1, LIU Han1, DONG Ze-han1, HUANG He-feng1, 2. Risk factors for gestational diabetes mellitus among multiparae [J]. , 2018, 38(6): 637-. |
[15] | MAO Rui-zhi1, 2, ZHANG Chen1, 2, FANG Yi-ru1, 2. Research progress of microglia and peripheral monocytes in mood disorders [J]. , 2018, 38(5): 552-. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||