Effect of montelukast on leukotriene B4 metabolism in asthma

doi:10.3969/j.issn.1674-8115.2023.05.008

Abstract

Abstract:

Objective ·To observe the effect of montelukast on the expressions of key genes in LTB4 (leukotriene B4) metabolic pathway in treating asthma and investigate the candidate intervene targets of asthma. Methods ·The acute, subacute, and chronic asthmatic mouse models characterizing by allergic airway disease (AAD) were set up by ovalbumin (OVA) and Al(OH)₃ sensitization and challenge and intervened by intragastric administration of montelukast and finally challenged by OVA for chronic asthma model. The pulmonary functions of mice were tested by unconstrained whole body plethysmograph, to quest the change patterns of airway hyperresponsiveness (AHR). The eosinophil (EOS) infiltration and goblet cell (GCL) hyperplasia in mouse lungs were detected by hematoxylin-eosin (HE) staining, to quest the pathologic features of airway allergic inflammation. The levels of immunoglobulin E (IgE), interferon γ (IFN-γ), and interleukin (IL) in bronchoalveolar lavage fluid (BALF) and serum were detected by ELISA and Milliplex kits, to quest the helper T cell type 2 (Th2) inflammation status. The transcription and protein levels of 5-lipoxygenase activating protein (ALOX5AP), leukotriene A4 hydrolase (LTA4H), and leukotriene B4 receptor 1 (BLT1) genes, which encoded the rate-limiting enzymes in LTB4 synthesis pathway, were detected by RT-qPCR, Western blotting and immunohistochemistry (IHC). Results ·The asthmatic mouse model could be set up by OVA and Al (OH)₃ and was presented as AHR characterized by increasing enhanced pause (Penh) value, eosinophilic inflammation and high mucous secretion pathologically characterized by airway EOS infiltration and GCL hyperplasia, Th2 inflammation immunologically characterized by the increasing levels of IgE, IL-4, and IL-13 as well as decreasing levels of IFN-γ, IL-2, and IL-12 in BALF and serum. Montelukast could alleviate AAD effectively. The transcription and protein levels of ALOX5AP, LTA4H, and BLT1 genes increased in asthma. Montelukast can inhibit the expression of ALOX5AP gene and promote the expressions of LTB4 and BLT1 genes in asthmatic chronic phase. When challenged by OVA once again, montelukast can induce the significantly high expressions of LTB4 and BLT1 genes. Conclusion ·Montelukast has the effect of relieving allergic inflammation in asthma mice, but it can stimulate the production and accumulation of LTB4 and is significant in chronic phase. When challenged by OVA a second time, LTB4 could be promoted to combine with BLT1 and attend in the pathogenesis of asthma. The results suggested that there was a potential risk of activation of LTB4 by montelukast. The rate-limiting enzyme LTA4H and its receptor BLT1 metabolism may be potential targets for asthma treatment.

Key words: asthma, 5-lipoxygenase activating protein (ALOX5AP), leukotriene A4 hydrolase (LTA4H), leukotriene B4 receptor, montelukast

CLC Number:

R562

HU Yu, XIE Liang, ZOU Dan, FU Hongling, LOU Lili, XIE Keqi, LIU Hanmin. Effect of montelukast on leukotriene B4 metabolism in asthma[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(5): 580-591.

Figures/Tables 9

Fig 1 Setup of mice model with asthma

Tab 1 List of primers

Primer Name	Direction	Sequence (5′→3′)
ALOX5AP	Forward	TGTCGGCTATCTGGGAGAGAGA
ALOX5AP	Reverse	ATCCGCTTGCCGAAGATGTA
LTA4H	Forward	TTGATTGGAACACCTGGCTCTA
LTA4H	Reverse	TGTCAGAGTCACGTCGTAATTGG
BLT1	Forward	GGCACTAAGACAGATTCAAGGATT
BLT1	Reverse	ACATGCCACCAGGAGAAGAAG
Actin	Forward	TGGCTCCTAGCACCATGAAGA
Actin	Reverse	GCCACCGATCCACACAGAGT

Fig 2 Penh values of different mice groups

Fig 3 HE staining and scores of mice lung samples

Fig 4 Expression levels of IgE and cytokines in BALF and serum of mice

Fig 5 Transcription and protein levels of ALOX5AP gene

Fig 6 Transcription and protein levels of LTA4H gene

Fig 7 Transcription and protein levels of BLT1 gene

Fig 8 Transcription and protein levels of ALOX5AP, LTA4H and BLT1 genes after re-challenged by OVA in asthma mice models

TrendMD

References 37

1	JOHNSON C C, CHANDRAN A, HAVSTAD S, et al. US childhood asthma incidence rate patterns from the ECHO consortium to identify high-risk groups for primary prevention[J]. JAMA Pediatr, 2021, 175(9): 919-927.
2	MESHRAM D, BHARDWAJ K, RATHOD C, et al. The role of leukotrienes inhibitors in the management of chronic inflammatory diseases[J]. Recent Pat Inflamm Allergy Drug Discov, 2020, 14(1): 15-31.
3	YAMAMOTO T, MIYATA J, ARITA M, et al. Current state and future prospect of the therapeutic strategy targeting cysteinyl leukotriene metabolism in asthma[J]. Respir Investig, 2019, 57(6): 534-543.
4	NIALS A T, UDDIN S. Mouse models of allergic asthma: acute and chronic allergen challenge[J]. Dis Model Mech, 2008, 1(4/5): 213-220.
5	LOCKE N R, ROYCE S G, WAINEWRIGHT J S, et al. Comparison of airway remodeling in acute, subacute, and chronic models of allergic airways disease[J]. Am J Respir Cell Mol Biol, 2007, 36(5): 625-632.
6	PADRID P, SNOOK S, FINUCANE T, et al. Persistent airway hyperresponsiveness and histologic alterations after chronic antigen challenge in cats[J]. Am J Respir Crit Care Med, 1995, 151(1): 184-193.
7	CHO K S, PARK M K, KANG S A, et al. Adipose-derived stem cells ameliorate allergic airway inflammation by inducing regulatory T cells in a mouse model of asthma[J]. Mediators Inflamm, 2014, 2014: 436476.
8	MIYATA J, FUKUNAGA K, KAWASHIMA Y, et al. Cysteinyl leukotriene metabolism of human eosinophils in allergic disease[J]. Allergol Int, 2020, 69(1): 28-34.
9	BRUNO F, SPAZIANO G, LIPARULO A, et al. Recent advances in the search for novel 5-lipoxygenase inhibitors for the treatment of asthma[J]. Eur J Med Chem, 2018, 153: 65-72.
10	LECHNER A, HENKEL F D R, HARTUNG F, et al. Macrophages acquire a TNF-dependent inflammatory memory in allergic asthma[J]. J Allergy Clin Immunol, 2022, 149(6): 2078-2090.
11	RO M, LEE A J, KIM J H. 5-/ 12-Lipoxygenase-linked cascade contributes to the IL-33-induced synthesis of IL-13 in mast cells, thus promoting asthma development[J]. Allergy, 2018, 73(2): 350-360.
12	DOHERTY T A, KHORRAM N, LUND S, et al. Lung type 2 innate lymphoid cells express cysteinyl leukotriene receptor 1, which regulates TH2 cytokine production[J]. J Allergy Clin Immunol, 2013, 132(1): 205-213.
13	THIVIERGE M, STANKOVÁ J, ROLA-PLESZCZYNSKI M. IL-13 and IL-4 up-regulate cysteinyl leukotriene 1 receptor expression in human monocytes and macrophages[J]. J Immunol, 2001, 167(5): 2855-2860.
14	ZHOU X J, QIN Z, LU J, et al. Efficacy and safety of salmeterol/fluticasone compared with montelukast alone (or add-on therapy to fluticasone) in the treatment of bronchial asthma in children and adolescents: a systematic review and meta-analysis[J]. Chin Med J, 2021, 134(24): 2954-2961.
15	DEBELLEIX S, SIAO-HIM FA V, BEGUERET H, et al. Montelukast reverses airway remodeling in actively sensitized young mice[J]. Pediatr Pulmonol, 2018, 53(6): 701-709.
16	WANG W L, LUO X M, ZHANG Q, et al. Bifidobacterium infantis relieves allergic asthma in mice by regulating Th1/Th2[J]. Med Sci Monit, 2020, 26: e920583.
17	SUN W, LIU H Y. Montelukast and budesonide for childhood cough variant asthma[J]. J Coll Physicians Surg Pak, 2019, 29(4): 345-348.
18	ELIEH ALI KOMI D, BJERMER L. Mast cell-mediated orchestration of the immune responses in human allergic asthma: current insights[J]. Clin Rev Allergy Immunol, 2019, 56(2): 234-247.
19	BRIGHTLING C E, BRUSSELLE G, ALTMAN P. The impact of the prostaglandin D₂ receptor 2 and its downstream effects on the pathophysiology of asthma[J]. Allergy, 2020, 75(4): 761-768.
20	SCHEXNAYDRE E E, GERSTMEIER J, GARSCHA U, et al. A 5‑lipoxygenase-specific sequence motif impedes enzyme activity and confers dependence on a partner protein[J]. Biochim Biophys Acta Mol Cell Biol Lipids, 2019, 1864(4): 543-551.
21	MUÑOZ N M, MELITON A Y, MELITON L N, et al. Secretory group V phospholipase A₂ regulates acute lung injury and neutrophilic inflammation caused by LPS in mice[J]. Am J Physiol Lung Cell Mol Physiol, 2009, 296(6): L879-L887.
22	LESLIE C C. Cytosolic phospholipase A₂: physiological function and role in disease[J]. J Lipid Res, 2015, 56(8): 1386-1402.
23	SOKOLOWSKA M, STEFANSKA J, WODZ-NASKIEWICZ K, et al. Cytosolic phospholipase A2 group IVA is overexpressed in patients with persistent asthma and regulated by the promoter microsatellites[J]. J Allergy Clin Immunol, 2010, 125(6): 1393-1395.
24	GRANATA F, STAIANO R I, LOFFREDO S, et al. The role of mast cell-derived secreted phospholipases A2 in respiratory allergy[J]. Biochimie, 2010, 92(6): 588-593.
25	TOUQUI L. Antisense inhibition of phospholipase A2: a new approach for already tested therapeutic targets for the treatment of sepsis[J]. Crit Care Med, 2012, 40(7): 2250-2251.
26	ZAMAN K, HANIGAN M H, SMITH A, et al. Endogenous S-nitrosoglutathione modifies 5-lipoxygenase expression in airway epithelial cells[J]. Am J Respir Cell Mol Biol, 2006, 34(4): 387-393.
27	KOGA T, SASAKI F, SAEKI K, et al. Expression of leukotriene B₄ receptor 1 defines functionally distinct DCs that control allergic skin inflammation[J]. Cell Mol Immunol, 2021, 18(6): 1437-1449.
28	PAL K, FENG X, STEINKE J W, et al. Leukotriene A4 hydrolase activation and leukotriene B4 production by eosinophils in severe asthma[J]. Am J Respir Cell Mol Biol, 2019, 60(4): 413-419.
29	HE R, CHEN Y, CAI Q. The role of the LTB4-BLT1 axis in health and disease[J]. Pharmacol Res, 2020, 158: 104857.
30	UCHIDA Y, SOMA T, NAKAGOME K, et al. Implications of prostaglandin D₂ and leukotrienes in exhaled breath condensates of asthma[J]. Ann Allergy Asthma Immunol, 2019, 123(1): 81-88.e1.
31	PREEZ S D, RAIDAL S L, DORAN G S, et al. Exhaled breath condensate hydrogen peroxide, pH and leukotriene B₄ are associated with lower airway inflammation and airway cytology in the horse[J]. Equine Vet J, 2019, 51(1): 24-32.
32	STAPLETON R D, SURATT B T, NEFF M J, et al. Bronchoalveolar fluid and plasma inflammatory biomarkers in contemporary ARDS patients[J]. Biomarkers, 2019, 24(4): 352-359.
33	BERRY K A, BORGEAT P, GOSSELIN J, et al. Urinary metabolites of leukotriene B₄ in the human subject[J]. J Biol Chem, 2003, 278(27): 24449-24460.
34	LEE J J, DIMINA D, MACIAS M P, et al. Defining a link with asthma in mice congenitally deficient in eosinophils[J]. Science, 2004, 305(5691): 1773-1776.
35	ASANUMA F, KUWABARA K, ARIMURA A, et al. Effects of leukotriene B₄ receptor antagonist, LY293111Na, on antigen-induced bronchial hyperresponsiveness and leukocyte infiltration in sensitized guinea pigs[J]. Inflamm Res, 2001, 50(3): 136-141.
36	KUBO M. Mast cells and basophils in allergic inflammation[J]. Curr Opin Immunol, 2018, 54: 74-79.
37	LEE Y J, KIM C K. Montelukast use over the past 20 years: monitoring of its effects and safety issues[J]. Clin Exp Pediatr, 2020, 63(10): 376-381.

[1]	JIANG Yunli, LI Aiqiu, XIAO Yanshang, LI Tiantian, HU Yachen, ZHANG Xiaoxiao, WU Beirong. Application of continuous nursing based on EMS management mode in preschool children with wheezing diseases [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(2): 228-236.
[2]	SHI Zelun, WANG Qing, HE Wen, FU Weijia, WANG Yingwen, HAN Xiao, ZHANG Xiaobo. Nanoplastics aggravate severe asthma by inducing DNA damage of alveolar type Ⅱ epithelial cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1391-1405.
[3]	ZHAO Yanhong, WANG Chuanping. Review of CD4⁺ T cell subsets in asthma phenotypes: molecular mechanisms and biologic treatment options [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(8): 1064-1070.
[4]	WEN Yajin, HE Wen, HAN Xiao, ZHANG Xiaobo. Exploratory analysis of gut microbiota differences in childhood asthma with different severity [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 655-664.
[5]	WANG Yingwen, LI Xiaoling, DAI Jiajia, LIU Fang, HUANG Jianfeng, WANG Libo, ZHANG Xiaobo, FENG Rui. Epidemiological characteristics and risk factors of severe asthma in children: a single-center prospective cohort study [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 665-672.
[6]	LI Pengyun, DAI Yinfang, LU Yanhong, YU Xingmei, XU Lina, DI Wujianfeng, HAO Chuangli. Clinical study of exhaled nitric oxide in children with asthma and allergic rhinitis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 673-679.
[7]	DANG Xiangyang, TANG Yuyi, LI Weiguo, LIU Enmei. Diagnostic value of fractional exhaled nitric oxide in predicting cough variant asthma in children with chronic cough: a systematic review and meta-analysis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 680-688.
[8]	XU Yinglian, TIAN Jing, ZHANG Xiang, ZHAO Shunying. Research progress in the roles of airway epithelial cells in the pathogenesis of asthma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(5): 619-623.
[9]	ZHU Siyu, DONG Xiaoyan. New insights in small airway dysfunction of childhood asthma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(4): 500-506.
[10]	ZHENG Guimei, TANG Lanfang. Clinical significance of FEV_0.5 and FEV_0.75 in the determination of pulmonary function in children with bronchial asthma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(10): 1262-1267.
[11]	DENG Yuntian, XIONG Wenkui, ZHU Rui, LIU Enmei, LI Xuemei, ZHONG Zhaohui. A case-control study of the relationship between early-life environmental exposure and childhood asthma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(1): 44-51.
[12]	KANG Wenhui, CHEN Yiting, ZHAO Anda, LI Rong, LI Shenghui. Research progress of the mechanism of melatonin in the pathogenesis and course of asthma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 667-672.
[13]	CHEN Yiting, ZHAO Anda, LI Rong, KANG Wenhui, LI Shenghui. Review of the role of circulating exosomal microRNA in bronchial asthma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(3): 375-380.
[14]	YAO Tao, AO Min, PENG Yin-yin, JIANG Li-sha, GUO Shu-liang . Comparison analysis of clinical characteristic of non-organic dyspnea and asthma both with a complaint of dyspnea#br# [J]. , 2017, 37(7): 959-.
[15]	WU Lei, XIA Yi-meng, FAN Qiu-wei. Effects of low tidal volume mechanical ventilation and low level of positive end expiratory pressure on respiratory function in patients with asthma under general anesthesia#br# [J]. , 2017, 37(10): 1413-.