Journal of Shanghai Jiao Tong University (Medical Science) ›› 2023, Vol. 43 ›› Issue (9): 1107-1114.doi: 10.3969/j.issn.1674-8115.2023.09.005
• Basic research • Previous Articles
LI Qianyu1(), GUO Wenyun1, QIAN Yifei1, LI Songling2, ZHU Zijun1, LIU Yanfeng1,3(
)
Received:
2023-08-16
Accepted:
2023-09-18
Online:
2023-09-28
Published:
2023-09-28
Contact:
LIU Yanfeng
E-mail:qianyu_lli@163.com;lyf7858188@163.com
Supported by:
CLC Number:
LI Qianyu, GUO Wenyun, QIAN Yifei, LI Songling, ZHU Zijun, LIU Yanfeng. Study on the significance and mechanism of ASGR1 in hepatocellular carcinoma[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(9): 1107-1114.
sgRNA | Forward (5′→3′) | Reverse (5′→3′) |
---|---|---|
Asgr1-sgRNA-1 | CACCGCGCTGCAAGAGCCGTGGAGT | AAACACTCCACGGCTCTTGCAGCGC |
Asgr1-sgRNA-2 | CACCGGACCATCATCAACTCCGGAG | AAACCTCCGGAGTTGATGATGGTCC |
Tab 1 Sequence for sgRNA (5′→3′)
sgRNA | Forward (5′→3′) | Reverse (5′→3′) |
---|---|---|
Asgr1-sgRNA-1 | CACCGCGCTGCAAGAGCCGTGGAGT | AAACACTCCACGGCTCTTGCAGCGC |
Asgr1-sgRNA-2 | CACCGGACCATCATCAACTCCGGAG | AAACCTCCGGAGTTGATGATGGTCC |
Primer | Forward (5′→3′) | Reverse (5′→3′) |
---|---|---|
Actb | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
Hk2 | TGATCGCCTGCTTATTCACGG | AACCGCCTAGAAATCTCCAGA |
Pgk1 | ATGTCGCTTTCCAACAAGCTG | GCTCCATTGTCCAAGCAGAAT |
Pkm2 | GCCGCCTGGACATTGACTC | CCATGAGAGAAATTCAGCCGAG |
Tab 2 Primer sequence for PCR (5′→3′)
Primer | Forward (5′→3′) | Reverse (5′→3′) |
---|---|---|
Actb | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
Hk2 | TGATCGCCTGCTTATTCACGG | AACCGCCTAGAAATCTCCAGA |
Pgk1 | ATGTCGCTTTCCAACAAGCTG | GCTCCATTGTCCAAGCAGAAT |
Pkm2 | GCCGCCTGGACATTGACTC | CCATGAGAGAAATTCAGCCGAG |
Fig 5 Bioinformatics analysis of ASGR1 expression in TCGA liver cancer database and verification of mRNA expression levels in mouse liver cancer tissue
1 | BRAY F, FERLAY J, SOERJOMATARAM I, et al. Global cancer statistics 2018: globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2018, 68(6): 394-424. |
2 | SUNG H, FERLAY J, SIEGEL R L, et al. Global cancer statistics 2020: globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2021, 71(3): 209-249. |
3 | SINGAL A G, LAMPERTICO P, NAHON P. Epidemiology and surveillance for hepatocellular carcinoma: new trends[J]. J Hepatol, 2020, 72(2): 250-261. |
4 | SINGH M K, DAS B K, CHOUDHARY S, et al. Diabetes and hepatocellular carcinoma: a pathophysiological link and pharmacological management[J]. Biomed Pharmacother, 2018, 106: 991-1002. |
5 | ASHWELL G, HARFORD J. Carbohydrate-specific receptors of the liver[J]. Annu Rev Biochem, 1982, 51: 531-554. |
6 | TANOWITZ M, HETTRICK L, REVENKO A, et al. Asialoglycoprotein receptor 1 mediates productive uptake of N-acetylgalactosamine-conjugated and unconjugated phosphorothioate antisense oligonucleotides into liver hepatocytes[J]. Nucleic Acids Res, 2017, 45(21): 12388-12400. |
7 | 夏梦蝶, 廖韦, 向琼, 等. 去唾液酸糖蛋白受体1在动脉粥样硬化中的研究进展[J]. 中国动脉硬化杂志, 2022, 30(6): 541-545. |
XIA M D, LIAO W, XIANG Q, et al. Research progress of asialoglycoprotein receptor 1 in atherosclerosis[J]. Chinese Journal of Arteriosclerosis, 2022, 30(6): 541-545. | |
8 | DE GALARRETA M R, BRESNAHAN E, MOLINA-SÁNCHEZ P, et al. β-catenin activation promotes immune escape and resistance to anti-PD-1 therapy in hepatocellular carcinoma[J]. Cancer Discov, 2019, 9(8): 1124-1141. |
9 | SIEGEL R L, MILLER K D, WAGLE N S, et al. Cancer statistics, 2023[J]. CA A Cancer J Clinicians, 2023, 73(1): 17-48. |
10 | RAHIB L, SMITH B D, AIZENBERG R, et al. Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid, liver, and pancreas cancers in the United States[J]. Cancer Res, 2014, 74(11): 2913-2921. |
11 | ZHOU J, SUN H C, WANG Z, et al. Guidelines for the diagnosis and treatment of hepatocellular carcinoma (2019 edition)[J]. Liver Cancer, 2020, 9(6): 682-720. |
12 | EL-SERAG H B. Hepatocellular carcinoma[J]. N Engl J Med, 2011, 365(12): 1118-1127. |
13 | LLOVET J M, KELLEY R K, VILLANUEVA A, et al. Hepatocellular carcinoma[J]. Nat Rev Dis Primers, 2021, 7(1): 6. |
14 | Gilbert Ashwell: sweet on science[J]. Nat Med, 2008, 14(6): 608. |
15 | GREWAL P K. The ashwell-morell receptor[J]. Methods Enzymol, 2010, 479: 223-241. |
16 | SUGAHARA K, TOGASHI H, TAKAHASHI K, et al. Separate analysis of asialoglycoprotein receptors in the right and left hepatic lobes using Tc-GSA SPECT[J]. Hepatology, 2003, 38(6): 1401-1409. |
17 | GREWAL P K, UCHIYAMA S, DITTO D, et al. The Ashwell receptor mitigates the lethal coagulopathy of sepsis[J]. Nat Med, 2008, 14(6): 648-655. |
18 | WANG J Q, LI L L, HU A, et al. Inhibition of ASGR1 decreases lipid levels by promoting cholesterol excretion[J]. Nature, 2022, 608(7922): 413-420. |
19 | RIGOPOULOU E I, ROGGENBUCK D, SMYK D S, et al. Asialoglycoprotein receptor (ASGPR) as target autoantigen in liver autoimmunity: lost and found[J]. Autoimmun Rev, 2012, 12(2): 260-269. |
20 | WITZIGMANN D, QUAGLIATA L, SCHENK S H, et al. Variable asialoglycoprotein receptor 1 expression in liver disease: implications for therapeutic intervention[J]. Hepatol Res, 2016, 46(7): 686-696. |
21 | GU D, JIN H, JIN G, et al. The asialoglycoprotein receptor suppresses the metastasis of hepatocellular carcinoma via LASS2-mediated inhibition of V-ATPase activity[J]. Cancer Lett, 2016, 379(1): 107-116. |
22 | ZHU X X, SONG G Y, ZHANG S Y, et al. Asialoglycoprotein receptor 1 functions as a tumor suppressor in liver cancer via inhibition of STAT3[J]. Cancer Res, 2022, 82(21): 3987-4000. |
23 | TONG M, WONG T L, ZHAO H, et al. Loss of tyrosine catabolic enzyme HPD promotes glutamine anaplerosis through mTOR signaling in liver cancer[J]. Cell Rep, 2021, 36(8): 109617. |
24 | FAUBERT B, SOLMONSON A, DEBERARDINIS R J. Metabolic reprogramming and cancer progression[J]. Science, 2020, 368(6487): eaaw5473. |
25 | YEH Y C, HO H L, WU Y C, et al. AKT1 internal tandem duplications and point mutations are the genetic hallmarks of sclerosing pneumocytoma[J]. Mod Pathol, 2020, 33(3): 391-403. |
26 | HÖNIGOVA K, NAVRATIL J, PELTANOVA B, et al. Metabolic tricks of cancer cells[J]. Biochim Biophys Acta BBA Rev Cancer, 2022, 1877(3): 188705. |
27 | CAI J, SUN X H, GUO H, et al. Non-metabolic role of UCK2 links EGFR-AKT pathway activation to metastasis enhancement in hepatocellular carcinoma[J]. Oncogenesis, 2020, 9(12): 103. |
28 | ICARD P, SIMULA L, WU Z R, et al. Why may citrate sodium significantly increase the effectiveness of transarterial chemoembolization in hepatocellular carcinoma?[J]. Drug Resist Updat, 2021, 59: 100790. |
29 | BUONTEMPO F, ERSAHIN T, MISSIROLI S, et al. Inhibition of Akt signaling in hepatoma cells induces apoptotic cell death independent of Akt activation status[J]. Invest New Drugs, 2011, 29(6): 1303-1313. |
30 | TIAN L Y, SMIT D J, JÜCKER M. The role of PI3K/AKT/mTOR signaling in hepatocellular carcinoma metabolism[J]. Int J Mol Sci, 2023, 24(3): 2652. |
[1] | YU Li, SU Xiandu, ZHANG Min, LI Yahui, WANG Le. Construction and validation of prognostic risk model for hepatocellular carcinoma based on biological analysis of palmitoyl-associated enzyme long-chain non-coding RNA [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 747-754. |
[2] | LU Yu, WANG Hao, BA Qian. Role of gut microbiota in hepatocellular carcinoma: cancer occurrence, progresses and treatments [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(7): 939-944. |
[3] | HU Zhexuan, ZHANG Xin, WO Lulu, LI Jingchi, WANG Jiao, ZHOU Cixiang, ZHAO Qian. Study on the function of TRMT61A in liver cancer cell and its mechanism [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(6): 742-750. |
[4] | HU Chanchan, FAN Yi, XU Yuan, HU Zhijian, ZENG Yiming. Lipid metabolism and lung cancer: emerging roles in occurrence, progression, diagnosis and treatment [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(12): 1766-1771. |
[5] | Yihuan WANG, Ruokun LI, Huanhuan CHONG, Fuhua YAN. Research progress of Gd-EOB-DTPA-enhanced magnetic resonance imaging in the evaluation of biological behavior of hepatocellular carcinoma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(1): 130-134. |
[6] | Lei XIONG, Qian YI, Ming-fang XU, Jian CHEN. Expression and prognosis analysis of MRPL12 in lung adenocarcinoma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 1033-1040. |
[7] | WANG Jun-ying1, LI Xin1, YIN Ting-yu2, LIU Jia2, WANG Xiao-dong3, ZHONG Hua1. Effects of bone marrow mesenchymal cells immune thrombocytopenia patients on the biological behaviors of megakaryocytes [J]. , 2018, 38(6): 616-. |
[8] | HUANG Jin-guo1*, ZHANG Hai-nan1*, CHEN Zi-qing1*, YANG Li-na2, GUO Shu-juan1, TAO Sheng-ce1. Metabolomics study of the effect of arsenic trioxide on hepatocellular carcinoma cell line HepG2 [J]. , 2018, 38(10): 1145-. |
[9] | HAN Ke-qi*, RUAN Xin*, HE Ming. Roles of SIRT2 in the tumorigenesis and development of hepatocellular carcinoma [J]. , 2018, 38(10): 1247-. |
[10] | LI Yong-ning, XIONG Xiao-jing,LI Qing-song, LIU Ying, HU Zheng, CAO Wen-wu. Study on the mechanism of in vitro apoptosis induced with 5-aminolevulinic acid-mediated sonodynamic therapy in Hep G2 cells [J]. , 2016, 36(5): 648-. |
[11] | LUO Cui-song, LIN Yun, ZOU Wei-bing, SHI Jun. Clinicopathologic characteristics and prognostic factors for hepatocellular carcinoma patients with diabetes mellitus [J]. , 2016, 36(12): 1736-. |
[12] | CHEN Mo, ZHAO Kun, LIU Peng-cheng, WANG Gen-nian, WEI Feng-xian, NI Rui, XU Xiao-dong, ZHANG You-cheng . Effects of silencing GP73 with siRNA interference on the migration and invasion of human hepatoma HepG2 cells [J]. , 2016, 36(11): 1588-. |
[13] | XU Yi-Wei, SUN Han-dong, HUANG Ying. Effects of autophagy on adenanthin-induced death of human hepatocellular carcinoma Bel-7402 cells [J]. , 2015, 35(8): 1130-. |
[14] | LONG Man-mei, HUANG Xiao-ying, YAO Jin-guang, et al. Correlation between microRNA-24 expression and prognosis of aflatoxin B1-related hepatocellular carcinoma prognosis [J]. , 2014, 34(12): 1743-. |
[15] | LONG Xi-dai, YAO Jin-guang, HUANG Xiao-ying, et al. Molecular epidemiology studies on aflatoxin B1-related hepatocellular carcinoma [J]. , 2013, 33(9): 1187-. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||