Study on the significance and mechanism of ASGR1 in hepatocellular carcinoma

doi:10.3969/j.issn.1674-8115.2023.09.005

Abstract

Abstract:

Objective ·To explore the significance and mechanism of asialoglycoprotein receptor 1 (ASGR1) in hepatocellular carcinoma. Methods ·The expression of ASGR1 in patients with liver cancer in The Cancer Genome Atlas (TCGA) database was analyzed by R language and the related survival curves were drawn. The Human Protein Atlas (HPA) database was used to obtain the immunohistochemistry (IHC) data of normal human liver tissue and liver cancer tissue to analyze the protein expression of ASGR1. By using the hydrodynamic tail vein injection (HTVI) delivery method, Asgr1 was knocked out in the liver of fully immune mice to explore its tumorigenic function invivo. Gene knockout efficiency was verified by Western blotting (WB). The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis and correlation analysis were performed by using R language. The GSEA hallmark correlation pathway analysis was performed by using Gene Set Enrichment Analysis (GSEA) software. The expression level of key genes of glycolysis in mouse liver cancer tissue was verified by quantitative real-time PCR (qPCR). Results ·ASGR1 was significantly low-expressed in liver cancer tissue, and the low expression of ASGR1 in liver cancer patients was associated with poorer overall survival (OS), disease-free interval (DFI), progression-free interval (PFI), and disease-specific survival (DSS). The higher the degree of tumor grade, the lower the expression level of ASGR1 in patients with liver cancer. Immunohistochemistry showed that the protein expression of ASGR1 in normal human liver tissue was significantly higher than that in liver cancer tissue. In an immunocompetent mouse model of hepatocellular carcinoma, knockout of endogenous Asgr1 in mice increased the size and number of tumor nodules in liver tissue. In the TCGA database, patients with liver cancer in the ASGR1 low-expression group were enriched in multiple cancer and metabolic pathways. The expression of ASGR1 was negatively correlated with some key genes of glycolysis. The level of glycolysis in liver cancer tissues of mice in the Asgr1 knockout group was higher than that in the control group. It was suggested that the low expression of ASGR1 be likely to promote the growth and development of liver cancer and strengthen metabolic reprogramming to promote the anabolic development of tumors. Conclusion ·The expression of ASGR1 is significantly reduced in patients with liver cancer, which is positively correlated with the prognosis of patients. Knocking out Asgr1 in mice can promote the occurrence and development of hepatocellular carcinoma. ASGR1 can be used as a potential biomarker for poor prognosis of liver cancer and a new target for potential treatment.

Key words: asialoglycoprotein receptor 1 (ASGR1), hepatocellular carcinoma, hydrodynamic tail vein injection, therapeutic target

CLC Number:

R735.7

LI Qianyu, GUO Wenyun, QIAN Yifei, LI Songling, ZHU Zijun, LIU Yanfeng. Study on the significance and mechanism of ASGR1 in hepatocellular carcinoma[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(9): 1107-1114.

Figures/Tables 7

Tab 1 Sequence for sgRNA （5′→3′）

sgRNA	Forward (5′→3′)	Reverse (5′→3′)
Asgr1-sgRNA-1	CACCGCGCTGCAAGAGCCGTGGAGT	AAACACTCCACGGCTCTTGCAGCGC
Asgr1-sgRNA-2	CACCGGACCATCATCAACTCCGGAG	AAACCTCCGGAGTTGATGATGGTCC

Tab 2 Primer sequence for PCR （5′→3′）

Primer	Forward (5′→3′)	Reverse (5′→3′)
Actb	GGCTGTATTCCCCTCCATCG	CCAGTTGGTAACAATGCCATGT
Hk2	TGATCGCCTGCTTATTCACGG	AACCGCCTAGAAATCTCCAGA
Pgk1	ATGTCGCTTTCCAACAAGCTG	GCTCCATTGTCCAAGCAGAAT
Pkm2	GCCGCCTGGACATTGACTC	CCATGAGAGAAATTCAGCCGAG

Fig 1 Expression of ASGR1 in liver cancer samples and its correlation with prognosis

Fig 2 Protein expression level of ASGR1 in normal human liver tissue and liver cancer tissue

Fig 3 Schematic diagram of mouse hydrodynamic tail vein injection model

Fig 4 Validation of Asgr1 knockout and formation of hepatocellular carcinoma in mice

Fig 5 Bioinformatics analysis of ASGR1 expression in TCGA liver cancer database and verification of mRNA expression levels in mouse liver cancer tissue

TrendMD

References 30

1	BRAY F, FERLAY J, SOERJOMATARAM I, et al. Global cancer statistics 2018: globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2018, 68(6): 394-424.
2	SUNG H, FERLAY J, SIEGEL R L, et al. Global cancer statistics 2020: globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2021, 71(3): 209-249.
3	SINGAL A G, LAMPERTICO P, NAHON P. Epidemiology and surveillance for hepatocellular carcinoma: new trends[J]. J Hepatol, 2020, 72(2): 250-261.
4	SINGH M K, DAS B K, CHOUDHARY S, et al. Diabetes and hepatocellular carcinoma: a pathophysiological link and pharmacological management[J]. Biomed Pharmacother, 2018, 106: 991-1002.
5	ASHWELL G, HARFORD J. Carbohydrate-specific receptors of the liver[J]. Annu Rev Biochem, 1982, 51: 531-554.
6	TANOWITZ M, HETTRICK L, REVENKO A, et al. Asialoglycoprotein receptor 1 mediates productive uptake of N-acetylgalactosamine-conjugated and unconjugated phosphorothioate antisense oligonucleotides into liver hepatocytes[J]. Nucleic Acids Res, 2017, 45(21): 12388-12400.
7	夏梦蝶, 廖韦, 向琼, 等. 去唾液酸糖蛋白受体1在动脉粥样硬化中的研究进展[J]. 中国动脉硬化杂志, 2022, 30(6): 541-545.
	XIA M D, LIAO W, XIANG Q, et al. Research progress of asialoglycoprotein receptor 1 in atherosclerosis[J]. Chinese Journal of Arteriosclerosis, 2022, 30(6): 541-545.
8	DE GALARRETA M R, BRESNAHAN E, MOLINA-SÁNCHEZ P, et al. β-catenin activation promotes immune escape and resistance to anti-PD-1 therapy in hepatocellular carcinoma[J]. Cancer Discov, 2019, 9(8): 1124-1141.
9	SIEGEL R L, MILLER K D, WAGLE N S, et al. Cancer statistics, 2023[J]. CA A Cancer J Clinicians, 2023, 73(1): 17-48.
10	RAHIB L, SMITH B D, AIZENBERG R, et al. Projecting cancer incidence and deaths to 2030: the unexpected burden of thyroid, liver, and pancreas cancers in the United States[J]. Cancer Res, 2014, 74(11): 2913-2921.
11	ZHOU J, SUN H C, WANG Z, et al. Guidelines for the diagnosis and treatment of hepatocellular carcinoma (2019 edition)[J]. Liver Cancer, 2020, 9(6): 682-720.
12	EL-SERAG H B. Hepatocellular carcinoma[J]. N Engl J Med, 2011, 365(12): 1118-1127.
13	LLOVET J M, KELLEY R K, VILLANUEVA A, et al. Hepatocellular carcinoma[J]. Nat Rev Dis Primers, 2021, 7(1): 6.
14	Gilbert Ashwell: sweet on science[J]. Nat Med, 2008, 14(6): 608.
15	GREWAL P K. The ashwell-morell receptor[J]. Methods Enzymol, 2010, 479: 223-241.
16	SUGAHARA K, TOGASHI H, TAKAHASHI K, et al. Separate analysis of asialoglycoprotein receptors in the right and left hepatic lobes using Tc-GSA SPECT[J]. Hepatology, 2003, 38(6): 1401-1409.
17	GREWAL P K, UCHIYAMA S, DITTO D, et al. The Ashwell receptor mitigates the lethal coagulopathy of sepsis[J]. Nat Med, 2008, 14(6): 648-655.
18	WANG J Q, LI L L, HU A, et al. Inhibition of ASGR1 decreases lipid levels by promoting cholesterol excretion[J]. Nature, 2022, 608(7922): 413-420.
19	RIGOPOULOU E I, ROGGENBUCK D, SMYK D S, et al. Asialoglycoprotein receptor (ASGPR) as target autoantigen in liver autoimmunity: lost and found[J]. Autoimmun Rev, 2012, 12(2): 260-269.
20	WITZIGMANN D, QUAGLIATA L, SCHENK S H, et al. Variable asialoglycoprotein receptor 1 expression in liver disease: implications for therapeutic intervention[J]. Hepatol Res, 2016, 46(7): 686-696.
21	GU D, JIN H, JIN G, et al. The asialoglycoprotein receptor suppresses the metastasis of hepatocellular carcinoma via LASS2-mediated inhibition of V-ATPase activity[J]. Cancer Lett, 2016, 379(1): 107-116.
22	ZHU X X, SONG G Y, ZHANG S Y, et al. Asialoglycoprotein receptor 1 functions as a tumor suppressor in liver cancer via inhibition of STAT3[J]. Cancer Res, 2022, 82(21): 3987-4000.
23	TONG M, WONG T L, ZHAO H, et al. Loss of tyrosine catabolic enzyme HPD promotes glutamine anaplerosis through mTOR signaling in liver cancer[J]. Cell Rep, 2021, 36(8): 109617.
24	FAUBERT B, SOLMONSON A, DEBERARDINIS R J. Metabolic reprogramming and cancer progression[J]. Science, 2020, 368(6487): eaaw5473.
25	YEH Y C, HO H L, WU Y C, et al. AKT1 internal tandem duplications and point mutations are the genetic hallmarks of sclerosing pneumocytoma[J]. Mod Pathol, 2020, 33(3): 391-403.
26	HÖNIGOVA K, NAVRATIL J, PELTANOVA B, et al. Metabolic tricks of cancer cells[J]. Biochim Biophys Acta BBA Rev Cancer, 2022, 1877(3): 188705.
27	CAI J, SUN X H, GUO H, et al. Non-metabolic role of UCK2 links EGFR-AKT pathway activation to metastasis enhancement in hepatocellular carcinoma[J]. Oncogenesis, 2020, 9(12): 103.
28	ICARD P, SIMULA L, WU Z R, et al. Why may citrate sodium significantly increase the effectiveness of transarterial chemoembolization in hepatocellular carcinoma?[J]. Drug Resist Updat, 2021, 59: 100790.
29	BUONTEMPO F, ERSAHIN T, MISSIROLI S, et al. Inhibition of Akt signaling in hepatoma cells induces apoptotic cell death independent of Akt activation status[J]. Invest New Drugs, 2011, 29(6): 1303-1313.
30	TIAN L Y, SMIT D J, JÜCKER M. The role of PI3K/AKT/mTOR signaling in hepatocellular carcinoma metabolism[J]. Int J Mol Sci, 2023, 24(3): 2652.

[1]	YU Li, SU Xiandu, ZHANG Min, LI Yahui, WANG Le. Construction and validation of prognostic risk model for hepatocellular carcinoma based on biological analysis of palmitoyl-associated enzyme long-chain non-coding RNA [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 747-754.
[2]	LU Yu, WANG Hao, BA Qian. Role of gut microbiota in hepatocellular carcinoma: cancer occurrence, progresses and treatments [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(7): 939-944.
[3]	HU Zhexuan, ZHANG Xin, WO Lulu, LI Jingchi, WANG Jiao, ZHOU Cixiang, ZHAO Qian. Study on the function of TRMT61A in liver cancer cell and its mechanism [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(6): 742-750.
[4]	HU Chanchan, FAN Yi, XU Yuan, HU Zhijian, ZENG Yiming. Lipid metabolism and lung cancer: emerging roles in occurrence, progression, diagnosis and treatment [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(12): 1766-1771.
[5]	Yihuan WANG, Ruokun LI, Huanhuan CHONG, Fuhua YAN. Research progress of Gd-EOB-DTPA-enhanced magnetic resonance imaging in the evaluation of biological behavior of hepatocellular carcinoma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(1): 130-134.
[6]	Lei XIONG, Qian YI, Ming-fang XU, Jian CHEN. Expression and prognosis analysis of MRPL12 in lung adenocarcinoma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 1033-1040.
[7]	WANG Jun-ying1, LI Xin1, YIN Ting-yu2, LIU Jia2, WANG Xiao-dong3, ZHONG Hua1. Effects of bone marrow mesenchymal cells immune thrombocytopenia patients on the biological behaviors of megakaryocytes [J]. , 2018, 38(6): 616-.
[8]	HUANG Jin-guo1, ZHANG Hai-nan1, CHEN Zi-qing1*, YANG Li-na2, GUO Shu-juan1, TAO Sheng-ce1. Metabolomics study of the effect of arsenic trioxide on hepatocellular carcinoma cell line HepG2 [J]. , 2018, 38(10): 1145-.
[9]	HAN Ke-qi, RUAN Xin, HE Ming. Roles of SIRT2 in the tumorigenesis and development of hepatocellular carcinoma [J]. , 2018, 38(10): 1247-.
[10]	LI Yong-ning, XIONG Xiao-jing,LI Qing-song, LIU Ying, HU Zheng, CAO Wen-wu. Study on the mechanism of in vitro apoptosis induced with 5-aminolevulinic acid-mediated sonodynamic therapy in Hep G2 cells [J]. , 2016, 36(5): 648-.
[11]	LUO Cui-song, LIN Yun, ZOU Wei-bing, SHI Jun. Clinicopathologic characteristics and prognostic factors for hepatocellular carcinoma patients with diabetes mellitus [J]. , 2016, 36(12): 1736-.
[12]	CHEN Mo, ZHAO Kun, LIU Peng-cheng, WANG Gen-nian, WEI Feng-xian, NI Rui, XU Xiao-dong, ZHANG You-cheng . Effects of silencing GP73 with siRNA interference on the migration and invasion of human hepatoma HepG2 cells [J]. , 2016, 36(11): 1588-.
[13]	XU Yi-Wei, SUN Han-dong, HUANG Ying. Effects of autophagy on adenanthin-induced death of human hepatocellular carcinoma Bel-7402 cells [J]. , 2015, 35(8): 1130-.
[14]	LONG Man-mei, HUANG Xiao-ying, YAO Jin-guang, et al. Correlation between microRNA-24 expression and prognosis of aflatoxin B₁-related hepatocellular carcinoma prognosis [J]. , 2014, 34(12): 1743-.
[15]	LONG Xi-dai, YAO Jin-guang, HUANG Xiao-ying, et al. Molecular epidemiology studies on aflatoxin B₁-related hepatocellular carcinoma [J]. , 2013, 33(9): 1187-.