PTEN-regulated alternative splicing of FoxM1 affects tumor cell migration

doi:10.3969/j.issn.1674-8115.2023.11.001

Abstract

Abstract:

Objective ·To study the effect of phosphatase and tensin homolog on chromosome 10 (PTEN) on alternative splicing of forkhead box M1 (FoxM1), and its impact on tumor cell migration. Methods ·PTEN was knocked down by short hairpin RNA (shRNA) in human embryonic kidney 293T cells, human prostate cancer DU145 cells, human colorectal adenocarcinoma RKO cells, and human colon cancer SW480 and SW620 cells. Specific primers were designed for FoxM1 and its subtypes FoxM1B and FoxM1C, and the mRNA expression levels of FoxM1B and FoxM1C were detected by quantitative real-time PCR (qRT-PCR). FoxM1B and FoxM1C were overexpressed in DU145 cells, and their effects on tumor cell migration were tested by Transwell assay and wound healing assay. Immunofluorescence and dual luciferase reporter gene assay were used to explore the potential mechanism of differential regulation of tumor cell migration by FoxM1B and FoxM1C. Results ·① PTEN was knocked down in 293T, DU145, RKO, SW480, and SW620 cell lines. qRT-PCR results showed that compared with the control cells, the mRNA expression level of FoxM1B significantly increased in PTEN knockdown cells, while the mRNA expression level of FoxM1C decreased or remained unchanged. Knockdown of PTEN did not affect the transcription level of FoxM1, but caused the variable splicing of FoxM1 and promoted the generation of FoxM1B. ② Compared with the control cells, the number of DU145 cells migrating to the below chamber increased in the FoxM1B overexpression group (P=0.024), while the number of migrating DU145 cells in the FoxM1C overexpression group was lower (P=0.000). The healing ability of DU145 cells was significantly enhanced in the FoxM1B overexpression group (P=0.001), while the healing ability of DU145 cells was weakened in the FoxM1C overexpression group (P=0.021). Overall, FoxM1B and FoxM1C had opposite effects on tumor cell migration. FoxM1B promoted tumor cell migration, while FoxM1C inhibited tumor cell migration. ③ Neither FoxM1B nor FoxM1C overexpression could induce β-catenin to enter the nucleus. Dual luciferase reporter gene assay showed no difference in the transcriptional activity of FoxM1B and FoxM1C. The difference between FoxM1B and FoxM1C in the regulation of tumor metastasis was also not mediated by β-catenin translocation. Conclusion ·Knockdown of PTEN regulates the alternative splicing of FoxM1, leading to increasing expression of transcript FoxM1B, which plays a positive role in tumor cell migration.

Key words: phosphatase and tensin homolog (PTEN), forkhead box M1 (FoxM1), alternative splicing, tumor cell, migration

CLC Number:

R363.1

WANG Xiaoling, GE Mengkai, SHEN Shaoming. PTEN-regulated alternative splicing of FoxM1 affects tumor cell migration[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(11): 1339-1347.

Figures/Tables 5

TrendMD

References 30

1	NUSSINOV R, TSAI C J, JANG H. Anticancer drug resistance: an update and perspective[J]. Drug Resist Updat, 2021, 59: 100796.
2	LIN Y X, WANG Y, DING J X, et al. Reactivation of the tumor suppressor PTEN by mRNA nanoparticles enhances antitumor immunity in preclinical models[J]. Sci Transl Med, 2021, 13(599): eaba9772.
3	GAO P, HAO J L, XIE Q W, et al. PELO facilitates PLK1-induced the ubiquitination and degradation of Smad4 and promotes the progression of prostate cancer[J]. Oncogene, 2022, 41(21): 2945-2957.
4	LIU W W, XU L, WANG X, et al. PRDX1 activates autophagy via the PTEN-AKT signaling pathway to protect against cisplatin-induced spiral ganglion neuron damage[J]. Autophagy, 2021, 17(12): 4159-4181.
5	ÁLVAREZ-GARCIA V, TAWIL Y, WISE H M, et al. Mechanisms of PTEN loss in cancer: it′s all about diversity[J]. Semin Cancer Biol, 2019, 59: 66-79.
6	BYRNES K, BLESSINGER S, BAILEY N T, et al. Therapeutic regulation of autophagy in hepatic metabolism[J]. Acta Pharm Sin B, 2022, 12(1): 33-49.
7	FENG J W, DANG Y P, ZHANG W Q, et al. PTEN arginine methylation by PRMT6 suppresses PI3K-AKT signaling and modulates pre-mRNA splicing[J]. Proc Natl Acad Sci U S A, 2019, 116(14): 6868-6877.
8	PENG Q, ZHOU Y J, OYANG L, et al. Impacts and mechanisms of alternative mRNA splicing in cancer metabolism, immune response, and therapeutics[J]. Mol Ther, 2022, 30(3): 1018-1035.
9	FRANKIW L, BALTIMORE D, LI G D. Alternative mRNA splicing in cancer immunotherapy[J]. Nat Rev Immunol, 2019, 19(11): 675-687.
10	WANG K, DAI X Y, YU A, et al. Peptide-based PROTAC degrader of FOXM1 suppresses cancer and decreases GLUT1 and PD-L1 expression[J]. J Exp Clin Cancer Res, 2022, 41(1): 289.
11	VANGENDEREN C, HARKNESS T A A, ARNASON T G. The role of anaphase promoting complex activation, inhibition and substrates in cancer development and progression[J]. Aging, 2020, 12(15): 15818-15855.
12	HU G H, YAN Z W, ZHANG C, et al. FOXM1 promotes hepatocellular carcinoma progression by regulating KIF4A expression[J]. J Exp Clin Cancer Res, 2019, 38(1): 188.
13	NAKAMURA S, HIRANO I, OKINAKA K, et al. The FOXM1 transcriptional factor promotes the proliferation of leukemia cells through modulation of cell cycle progression in acute myeloid leukemia[J]. Carcinogenesis, 2010, 31(11): 2012-2021.
14	RATHER T B, PARVEIZ I, BHAT G A, et al. Evaluation of forkhead box M1 (FOXM1) gene expression in colorectal cancer[J]. Clin Exp Med, 2023, 23(6): 2385-2405.
15	LI S K M, SMITH D K, LEUNG W Y, et al. FoxM1c counteracts oxidative stress-induced senescence and stimulates Bmi-1 expression[J]. J Biol Chem, 2008, 283(24): 16545-16553.
16	NILSSON M B, SUN H Y, ROBICHAUX J, et al. A YAP/FOXM1 axis mediates EMT-associated EGFR inhibitor resistance and increased expression of spindle assembly checkpoint components[J]. Sci Transl Med, 2020, 12(559): eaaz4589.
17	SHEN S M, JI Y, ZHANG C, et al. Nuclear PTEN safeguards pre-mRNA splicing to link Golgi apparatus for its tumor suppressive role[J]. Nat Commun, 2018, 9(1): 2392.
18	MATSUSHITA M, FUJITA K, HAYASHI T, et al. Gut microbiota-derived short-chain fatty acids promote prostate cancer growth via IGF1 signaling[J]. Cancer Res, 2021, 81(15): 4014-4026.
19	KORVER W, ROOSE J, CLEVERS H. The winged-helix transcription factor Trident is expressed in cycling cells[J]. Nucleic Acids Res, 1997, 25(9): 1715-1719.
20	BARGER C J, ZHANG W, HILLMAN J, et al. Genetic determinants of FOXM1 overexpression in epithelial ovarian cancer and functional contribution to cell cycle progression[J]. Oncotarget, 2015, 6(29): 27613-27627.
21	TASSI R A, TODESCHINI P, SIEGEL E R, et al. FOXM1 expression is significantly associated with chemotherapy resistance and adverse prognosis in non-serous epithelial ovarian cancer patients[J]. J Exp Clin Cancer Res, 2017, 36(1): 63.
22	BU H T, TANG S S, LIU G T, et al. In silico, in vitro and in vivo studies: dibutyl phthalate promotes prostate cancer cell proliferation by activating Forkhead Box M1 and remission after Natura-α pretreatment[J]. Toxicology, 2023, 488: 153465.
23	MADHI H, LEE J S, CHOI Y E, et al. FOXM1 inhibition enhances the therapeutic outcome of lung cancer immunotherapy by modulating PD-L1 expression and cell proliferation[J]. Adv Sci (Weinh), 2022, 9(29): e2202702.
24	SHER G, MASOODI T, PATIL K, et al. Dysregulated FOXM1 signaling in the regulation of cancer stem cells[J]. Semin Cancer Biol, 2022, 86(Pt 3): 107-121.
25	KELLEHER F C, O′SULLIVAN H. FOXM1 in sarcoma: role in cell cycle, pluripotency genes and stem cell pathways[J]. Oncotarget, 2016, 7(27): 42792-42804.
26	CHEN W, SHIMANE T, KAWANO S, et al. Human papillomavirus 16 E6 induces FoxM1B in oral keratinocytes through GRHL2[J]. J Dent Res, 2018, 97(7): 795-802.
27	HUANG C, XIE D C, CUI J J, et al. FOXM1c promotes pancreatic cancer epithelial-to-mesenchymal transition and metastasis via upregulation of expression of the urokinase plasminogen activator system[J]. Clin Cancer Res, 2014, 20(6): 1477-1488.
28	LOK G T M, CHAN D W, LIU V W S, et al. Aberrant activation of ERK/FOXM1 signaling cascade triggers the cell migration/invasion in ovarian cancer cells[J]. PLoS One, 2011, 6(8): e23790.
29	ZHOU Y Z, WANG Q, CHU L, et al. FOXM1c promotes oesophageal cancer metastasis by transcriptionally regulating IRF1 expression[J]. Cell Prolif, 2019, 52(2): e12553.
30	TAYLOR B S, SCHULTZ N, HIERONYMUS H, et al. Integrative genomic profiling of human prostate cancer[J]. Cancer Cell, 2010, 18(1): 11-22.

shRNA	Sequences (5′→3′)
shEV	CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG
shPTEN#1	GATCTTGACCAATGGCTAAGT
shPTEN#2	CGGGAAGACAAGTTCATGTACTT

shRNA	Sequences (5′→3′)
shEV	CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG
shPTEN#1	GATCTTGACCAATGGCTAAGT
shPTEN#2	CGGGAAGACAAGTTCATGTACTT

Gene	Primer sequence (5′→3′)
FoxM1b-F	AAGCCAGGCTGGAAGAAC
FoxM1b-R	GTTTCTGCTGCTTAAACACC
FoxM1c-F	GAAGAACTCCATCCGCCACA
FoxM1c-R	TGATTCCAAGTGCTCGGGCA
FoxM1-F	GAGCAGAAACGGGAGACCTG
FoxM1-R	ACCTTAACCTGTCGCTGCTC

Gene	Primer sequence (5′→3′)
FoxM1b-F	AAGCCAGGCTGGAAGAAC
FoxM1b-R	GTTTCTGCTGCTTAAACACC
FoxM1c-F	GAAGAACTCCATCCGCCACA
FoxM1c-R	TGATTCCAAGTGCTCGGGCA
FoxM1-F	GAGCAGAAACGGGAGACCTG
FoxM1-R	ACCTTAACCTGTCGCTGCTC

[1]	YANG Na, LIU Junli, BAI Jing, YANG Siyi, HAN Jiming, ZHANG Huahua. HENMT1 promotes the proliferation and migration of gastric cancer by activating the PI3K-AKT-mTOR signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(6): 717-726.
[2]	YANG Han, LEI Hao, XU Bide, WU Hao, MA Xunjun, HUANG Yanbo, MAO Yuanqing, ZHANG Jingwei, WANG Jinwu. Application of fluoroscopic stereophotogrammetric analysis in the detection of aseptic loosening of prostheses [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1061-1068.
[3]	QIAN Liheng, WEN Kailing, LIAO Yingna, LI Shuxin, NIE Huizhen. Study on the effect and mechanism of sorting nexin 1 on inhibiting the proliferation and migration of colorectal cancer cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1124-1135.
[4]	HAN Yishan, XU Ziqi, TAO Mengyu, FAN Guangjian, YU Bo. PRMT6 promotes the proliferation and migration of breast cancer cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(8): 999-1010.
[5]	LI Huxiao, LI Xiaotian, ZHAO Xuri, ZHANG Huanyu, ZHOU Wei, SONG Zhongchen. Effects of gingipain extract on the biological characteristics of oral squamous cell carcinoma cell HN6 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(2): 161-168.
[6]	LIU Chenxi, HAN Lin, YANG Yi, ZHOU Han, LIU Yayun, SHENG Deqiao. GPR87 promotes invasion and migration through the RHO/ROCK pathway in non-small cell lung cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(12): 1514-1525.
[7]	WANG Wei, WANG Hongli, ALIBIYATI·i Ain, YILIYAER· Rousu, AYI NUER, YANG Liang. Function of vasohibin-2 and the mechanism of alternative splicing in triple-negative breast cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(12): 1526-1535.
[8]	ZHANG Zongwen, FENG Li, FAN Zhisong. Heterogeneous nuclear ribonucleoprotein H1 and its function in tumor development and metastasis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(12): 1615-1620.
[9]	LUO Lange, ZHENG Chao, LEI Ming. Promotive effect of cancer-testis antigen CT57 on proliferation, invasion, migration and epithelial-mesenchymal transition of liver cancer cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1335-1346.
[10]	GAO Kexing, LIAO Chunhua, LI Shengze, MA Shuangyu, HUANG Lei. Functional site analysis of mucin 1 in regulating the malignant characteristics of tumor cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1370-1382.
[11]	LI Yu, JIANG Yifan, TONG Rongliang, CHEN Diyu, WU Jian. Research progress in the relationship between FOXM1 and neoplasm metabolism [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(10): 1323-1329.
[12]	CHEN Ningdai, ZHOU Bingqian, CHEN Zheyi, CHEN Shiyu, ZHEN Yingxia. Effect of lysine demethylase 5C on renal carcinoma metastasis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(5): 571-579.
[13]	LIU Ziyang, WANG Xiaowen, CHEN Li. lncRNA GK-IT1 influences the carcinogenesis of non-small cell lung cancer cells through regulating aldolase A [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 591-601.
[14]	SUN Jinli, SONG Weiwei, XU Ming, LI Jingquan. Oxidative damage and malignant migration of hepatocellular carcinoma cells LM3 induced by 14 weeks exposure to sodium arsenite [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(12): 1677-1684.
[15]	YUAN Yongmei, CHENG Xiaodan, SUN Jiaan, CHANG Dongge, HE Yingying, LIU Chang. lncRNA NEAT1 affects the proliferation, invasion and migration of ox-LDL-induced human vascular smooth muscle cells through miR-377-3p/Wnt pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(11): 1534-1541.