
Journal of Shanghai Jiao Tong University (Medical Science) ›› 2024, Vol. 44 ›› Issue (11): 1370-1382.doi: 10.3969/j.issn.1674-8115.2024.11.004
• Basic research • Previous Articles Next Articles
GAO Kexing(
), LIAO Chunhua, LI Shengze, MA Shuangyu, HUANG Lei(
)
Received:2024-02-11
Accepted:2024-03-22
Online:2024-11-28
Published:2024-11-28
Contact:
HUANG Lei
E-mail:xingke_gao@163.com;leihuang@shsmu.edu.cn
Supported by:CLC Number:
GAO Kexing, LIAO Chunhua, LI Shengze, MA Shuangyu, HUANG Lei. Functional site analysis of mucin 1 in regulating the malignant characteristics of tumor cells[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1370-1382.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2024.11.004
| Primer | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| AQA | GCCTTGGCTGTCGCTCAGGCCCGCCGAAAGAAC | GTTCTTTCGGCGGGCCTGAGCGACAGCCAAGGC |
| S251R | CCTCCAATCACAGGACTTCTCCCCAG | CTGGGGAGAAGTCCTGTGATTGGAGG |
| N271S | TTCACATTTCAAGCCTCCAGTTTAATT | AATTAAACTGGAGGCTTGAAATGTGAA |
| V359I | ACGATCTCAGACATCAGCGTGAGTGAT | ATCACTCACGCTTACGTCTGAGATCGT |
| P418S | CAGCTGGACATCTTTTCAGCCCGGGAT | ATCCCGGGCTGAAAAGATGTCCAGCTG |
| N465H | TCTTACACACACCCAGCAGTGGCAGCC | GGCTGCCACTGCTGGGTGTGTGTAAGA |
Tab 1 Primer sequences for PCR
| Primer | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| AQA | GCCTTGGCTGTCGCTCAGGCCCGCCGAAAGAAC | GTTCTTTCGGCGGGCCTGAGCGACAGCCAAGGC |
| S251R | CCTCCAATCACAGGACTTCTCCCCAG | CTGGGGAGAAGTCCTGTGATTGGAGG |
| N271S | TTCACATTTCAAGCCTCCAGTTTAATT | AATTAAACTGGAGGCTTGAAATGTGAA |
| V359I | ACGATCTCAGACATCAGCGTGAGTGAT | ATCACTCACGCTTACGTCTGAGATCGT |
| P418S | CAGCTGGACATCTTTTCAGCCCGGGAT | ATCCCGGGCTGAAAAGATGTCCAGCTG |
| N465H | TCTTACACACACCCAGCAGTGGCAGCC | GGCTGCCACTGCTGGGTGTGTGTAAGA |
| Mutant | Cancer type | Location | Frequency/% |
|---|---|---|---|
| P418S | Lung squamous cell carcinoma | CD | 5.19 |
| T112P | Bladder urothelial carcinoma/pancreatic adenocarcinoma | N1 | 4.55 |
| P134A | Pancreatic adenocarcinoma/melanoma | VNTR | 3.90 |
| S251R | Esophagogastric cancer/stomach adenocarcinoma | N2 | 2.60 |
| V359I | Colorectal adenocarcinoma/breast invasive carcinoma | ED | 2.60 |
| G33R | Cutaneous squamous cell carcinoma | N1 | 1.95 |
| S55N | Uterine corpus endometrial carcinoma | N1 | 1.95 |
| P102L | Stomach adenocarcinoma | N1 | 1.95 |
| N271S | Breast invasive carcinoma | SEA | 1.95 |
| G305D | Stomach adenocarcinoma | SEA | 1.95 |
| D336Y | Lung adenocarcinoma | SEA | 1.95 |
| V359F | Breast invasive carcinoma | ED | 1.95 |
| P418L | Cutaneous squamous cell carcinoma | CD | 1.95 |
| N465H | Uterine corpus endometrioid carcinoma | CD | 1.95 |
Tab 2 Information of 14 MUC1 mutants with high frequency
| Mutant | Cancer type | Location | Frequency/% |
|---|---|---|---|
| P418S | Lung squamous cell carcinoma | CD | 5.19 |
| T112P | Bladder urothelial carcinoma/pancreatic adenocarcinoma | N1 | 4.55 |
| P134A | Pancreatic adenocarcinoma/melanoma | VNTR | 3.90 |
| S251R | Esophagogastric cancer/stomach adenocarcinoma | N2 | 2.60 |
| V359I | Colorectal adenocarcinoma/breast invasive carcinoma | ED | 2.60 |
| G33R | Cutaneous squamous cell carcinoma | N1 | 1.95 |
| S55N | Uterine corpus endometrial carcinoma | N1 | 1.95 |
| P102L | Stomach adenocarcinoma | N1 | 1.95 |
| N271S | Breast invasive carcinoma | SEA | 1.95 |
| G305D | Stomach adenocarcinoma | SEA | 1.95 |
| D336Y | Lung adenocarcinoma | SEA | 1.95 |
| V359F | Breast invasive carcinoma | ED | 1.95 |
| P418L | Cutaneous squamous cell carcinoma | CD | 1.95 |
| N465H | Uterine corpus endometrioid carcinoma | CD | 1.95 |
| 1 | KUFE D W. Mucins in cancer: function, prognosis and therapy[J]. Nat Rev Cancer, 2009, 9(12): 874-885. |
| 2 | ANDRIANIFAHANANA M, MONIAUX N, BATRA S K. Regulation of mucin expression: mechanistic aspects and implications for cancer and inflammatory diseases[J]. Biochim Biophys Acta, 2006, 1765(2): 189-222. |
| 3 | MONIAUX N, ANDRIANIFAHANANA M, BRAND R E, et al. Multiple roles of mucins in pancreatic cancer, a lethal and challenging malignancy[J]. Br J Cancer, 2004, 91(9): 1633-1638. |
| 4 | GAEMERS I C, VOS H L, VOLDERS H H, et al. A STAT-responsive element in the promoter of the episialin/MUC1 gene is involved in its overexpression in carcinoma cells[J]. J Biol Chem, 2001, 276(9): 6191-6199. |
| 5 | SHENG Y H, LOURIE R, LINDÉN S K, et al. The MUC13 cell-surface mucin protects against intestinal inflammation by inhibiting epithelial cell apoptosis[J]. Gut, 2011, 60(12): 1661-1670. |
| 6 | SINGH A P, MONIAUX N, CHAUHAN S C, et al. Inhibition of MUC4 expression suppresses pancreatic tumor cell growth and metastasis[J]. Cancer Res, 2004, 64(2): 622-630. |
| 7 | NATH S, MUKHERJEE P. MUC1: a multifaceted oncoprotein with a key role in cancer progression[J]. Trends Mol Med, 2014, 20(6): 332-342. |
| 8 | CHEN W Q, ZHANG Z, ZHANG S Q, et al. MUC1: structure, function, and clinic application in epithelial cancers[J]. Int J Mol Sci, 2021, 22(12): 6567. |
| 9 | HATTRUP C L, GENDLER S J. Structure and function of the cell surface (tethered) mucins[J]. Annu Rev Physiol, 2008, 70: 431-457. |
| 10 | LEVITIN F, STERN O, WEISS M, et al. The MUC1 SEA module is a self-cleaving domain[J]. J Biol Chem, 2005, 280(39): 33374-33386. |
| 11 | CARSON D D. The cytoplasmic tail of MUC1: a very busy place[J]. Sci Signal, 2008, 1(27): pe35. |
| 12 | KUFE D W. MUC1-C in chronic inflammation and carcinogenesis; emergence as a target for cancer treatment[J]. Carcinogenesis, 2020, 41(9): 1173-1183. |
| 13 | LENG Y M, CAO C, REN J, et al. Nuclear import of the MUC1-C oncoprotein is mediated by nucleoporin Nup62[J]. J Biol Chem, 2007, 282(27): 19321-19330. |
| 14 | RAINA D, AHMAD R, RAJABI H, et al. Targeting cysteine-mediated dimerization of the MUC1-C oncoprotein in human cancer cells[J]. Int J Oncol, 2012, 40(5): 1643-1649. |
| 15 | VAN PUTTEN J P M, STRIJBIS K. Transmembrane mucins: signaling receptors at the intersection of inflammation and cancer[J]. J Innate Immun, 2017, 9(3): 281-299. |
| 16 | YOLKEN R H, PETERSON J A, VONDERFECHT S L, et al. Human milk mucin inhibits rotavirus replication and prevents experimental gastroenteritis[J]. J Clin Invest, 1992, 90(5): 1984-1991. |
| 17 | LAU S K, WEISS L M, CHU P G. Differential expression of MUC1, MUC2, and MUC5AC in carcinomas of various sites: an immunohistochemical study[J]. Am J Clin Pathol, 2004, 122(1): 61-69. |
| 18 | KASHYAP B, KULLAA A M. Regulation of mucin 1 expression and its relationship with oral diseases[J]. Arch Oral Biol, 2020, 117: 104791. |
| 19 | SAFI F, KOHLER I, RÖTTINGER E, et al. The value of the tumor marker CA 15-3 in diagnosing and monitoring breast cancer[J]. Cancer, 1991, 68(3): 574-582. |
| 20 | STEINBERG W. The clinical utility of the CA 19-9 tumor-associated antigen[J]. Am J Gastroenterol, 1990, 85(4): 350-355. |
| 21 | SUPRUNIUK K, RADZIEJEWSKA I. MUC1 is an oncoprotein with a significant role in apoptosis (Review)[J]. Int J Oncol, 2021, 59(3): 68. |
| 22 | YAMAMOTO S, KAIMORI J Y, YOSHIMURA T, et al. Analysis of an ADTKD family with a novel frameshift mutation in MUC1 reveals characteristic features of mutant MUC1 protein[J]. Nephrol Dial Transplant, 2017, 32(12): 2010-2017. |
| 23 | WENZEL A, ALTMUELLER J, EKICI A B, et al. Single molecule real time sequencing in ADTKD-MUC1 allows complete assembly of the VNTR and exact positioning of causative mutations[J]. Sci Rep, 2018, 8(1): 4170. |
| 24 | LI Q F, CHU Y K, LI S Z, et al. The oncoprotein MUC1 facilitates breast cancer progression by promoting Pink1-dependent mitophagy via ATAD3A destabilization[J]. Cell Death Dis, 2022, 13(10): 899. |
| 25 | JIN W, LIAO X D, LV Y P, et al. MUC1 induces acquired chemoresistance by upregulating ABCB1 in EGFR-dependent manner[J]. Cell Death Dis, 2017, 8(8): e2980. |
| 26 | RAZAWI H, KINLOUGH C L, STAUBACH S, et al. Evidence for core 2 to core 1 O-glycan remodeling during the recycling of MUC1[J]. Glycobiology, 2013, 23(8): 935-945. |
| 27 | KINLOUGH C L, MCMAHAN R J, POLAND P A, et al. Recycling of MUC1 is dependent on its palmitoylation[J]. J Biol Chem, 2006, 281(17): 12112-12122. |
| 28 | PASTRELLO C, SANTAROSA M, FORNASARIG M, et al. MUC gene abnormalities in sporadic and hereditary mucinous colon cancers with microsatellite instability[J]. Dis Markers, 2005, 21(3): 121-126. |
| 29 | ZHANG L X, VLAD A, MILCAREK C, et al. Human mucin MUC1 RNA undergoes different types of alternative splicing resulting in multiple isoforms[J]. Cancer Immunol Immunother, 2013, 62(3): 423-435. |
| 30 | STRATTON M R, CAMPBELL P J, FUTREAL P A. The cancer genome[J]. Nature, 2009, 458(7239): 719-724. |
| 31 | MARTÍNEZ-JIMÉNEZ F, MUIÑOS F, SENTÍS I, et al. A compendium of mutational cancer driver genes[J]. Nat Rev Cancer, 2020, 20(10): 555-572. |
| 32 | NABAVINIA M S, GHOLOOBI A, CHARBGOO F, et al. Anti-MUC1 aptamer: a potential opportunity for cancer treatment[J]. Med Res Rev, 2017, 37(6): 1518-1539. |
| 33 | HOU Y, GAO J, XU H, et al. PPARγ E3 ubiquitin ligase regulates MUC1-C oncoprotein stability[J]. Oncogene, 2014, 33(49): 5619-5625. |
| 34 | LIAO C H, YU L P, PANG Z, et al. WWP1 targeting MUC1 for ubiquitin-mediated lysosomal degradation to suppress carcinogenesis[J]. Signal Transduct Target Ther, 2021, 6(1): 297. |
| 35 | ZHANG W B, LIU M W, YU L L, et al. Perturbation effect of single polar group substitution on the self-association of amphiphilic peptide helices[J]. J Colloid Interface Sci, 2022, 610: 1005-1014. |
| 36 | ZHANG W B, LIU M W, WANG Y, et al. β-sheet assembly translates conservative single-site mutation into a perturbation in macroscopic structure[J]. Nano Lett, 2023, 23(6): 2370-2378. |
| 37 | MACAO B, JOHANSSON D G, HANSSON G C, et al. Autoproteolysis coupled to protein folding in the SEA domain of the membrane-bound MUC1 mucin[J]. Nat Struct Mol Biol, 2006, 13(1): 71-76. |
| 38 | MERLIN J, STECHLY L, DE BEAUCÉ S, et al. Galectin-3 regulates MUC1 and EGFR cellular distribution and EGFR downstream pathways in pancreatic cancer cells[J]. Oncogene, 2011, 30(22): 2514-2525. |
| [1] | ZHU Zijun, QIAN Yife, LI Qianyu, LI Songling, QIN Wenli, LIU Yanfeng. Anaphase-promoting complex subunit 10 promotes hepatocellular carcinoma progression through regulation of the PI3K-AKT-mTOR signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(9): 1171-1182. |
| [2] | LI Siyu, CHEN Ya, HU Wentao, DAI Yongming, WU Yingwei. Using diffusion-relaxation correlation spectroscopic imaging to assess the heterogeneity of head and neck tumors and identify occult lymph node metastasis [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(9): 1202-1213. |
| [3] | WANG Rui, YUAN Ying, TAO Xiaofeng. Application value of synthetic magnetic resonance imaging in predicting cervical lymph node metastasis of oral cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(7): 900-909. |
| [4] | TANG Kairan, FENG Chengling, HAN Bangmin. Integrated single-cell and transcriptome sequencing to construct a prognostic model of M2 macrophage-related genes in prostate cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(5): 549-561. |
| [5] | XU Muxin, LIU Xian, JIANG Lishan, SUN Qing. Promotion of Nd:YAP laser biostimulation on the proliferation and osteogenic differentiation of human periodontal ligament cells through WNT/β-catenin signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(5): 562-569. |
| [6] | CHEN Yinan, ZHENG Yang, ZENG Hanlin, LEI Ming. Mechanism of Fas-associated protein with death domain in promoting proliferation of head and neck squamous cell carcinoma cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(4): 404-414. |
| [7] | ZHANG Boyuan, YAO Zhirong. Current research on UV-induced DNA damage and its role in promoting the development of skin malignancies [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(2): 228-232. |
| [8] | ZHANG Xianzhou, DU Fenglin, WU Lei, REN Yizhe, ZHAO Mingna, LOU Jiatao. Mechanistic study of OGT-promoted non-small cell lung cancer proliferation via the ERK signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(10): 1288-1297. |
| [9] | WU Shiyi, CHEN Si, LIU Bohan, LIU Yuting, LIU Yiwen, HE Yiqing, DU Yan, ZHANG Guoliang, GUO Qian, GAO Feng, YANG Cuixia. Role of "HA coat" in modulating stemness and endocrine resistance in ER+ breast cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(10): 1298-1307. |
| [10] | PANDIT Roshan, LU Junyao, HE Liheng, BAO Yujie, JI Ping, CHEN Yingying, XU Jie, WANG Ying. Role of tumor necrosis factor-α in coronavirus disease 2019-associated kidney injury [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(1): 1-10. |
| [11] | LI Xiang, WEI Ming, WU Wenxi, LUO Xiaoqin, YAO Biao, WU Siyu. Inhibitory effect of rutin on the growth and metastasis of osteosarcoma in vitro and in vivo [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(1): 20-28. |
| [12] | SUN Chenwei, HAI Wangxi, QU Qian, XI Yun. [18F]F-FMISO and [18F]F-FLT PET/CT dual-nuclide imaging for in vivo prediction of drug resistance in pancreatic cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(1): 60-68. |
| [13] | SHI Lingling, CHENG Yanyong, ZHANG Lei. Effects of sevoflurane exposure on proliferation and differentiation of primary oligodendrocytes [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1115-1123. |
| [14] | QIAN Liheng, WEN Kailing, LIAO Yingna, LI Shuxin, NIE Huizhen. Study on the effect and mechanism of sorting nexin 1 on inhibiting the proliferation and migration of colorectal cancer cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1124-1135. |
| [15] | MA Meili, TENG Jiajun, GAO Zhiqiang, SHI Chunlei, ZHONG Hua, HAN Baohui. Clinical and imaging analyses of primary mediastinal yolk sac tumor [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1155-1161. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||