Mechanistic study on the promotion of pancreatic cancer progression through upregulation of ZNF143 by dysregulated fatty acid metabolism

doi:10.3969/j.issn.1674-8115.2024.10.007

Abstract

Abstract:

Objective ·To identify key genes that may be regulated by fatty acid alteration in pancreatic cancer through tumor transcriptome screening, and to explore the expression of zinc finger protein 143 (ZNF143) in pancreatic cancer and its effect on the migration and invasion of pancreatic cancer cells. Methods ·The R language was utilized to integrate transcriptome data, including the GSE164760 dataset from the Gene Expression Omnibus (GEO) database, 179 pancreatic cancer tissue samples and 4 adjacent non-cancerous tissue samples from The Cancer Genome Atlas (TCGA) database, as well as 167 normal pancreatic tissue samples from the Genotype-Tissue Expression (GTEx) database. We conducted screening and analysis of potential differential genes that may be induced by dysregulation of fatty acid metabolism in pancreatic cancer. After treating pancreatic cancer cells with palmitic acid (PA) and oleic acid (OA) for 24 hours, the mRNA levels of candidate genes were detected by qRT-PCR. According to the median expression level of the screened gene, pancreatic cancer patients in the TCGA database were divided into two groups with high and low expression of ZNF143. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway and Gene Ontology (GO) enrichment analyses were performed for the differential genes of the two groups. siRNA was used to knock down the expression of ZNF143 in pancreatic cancer cells, and the effects on cell migration and invasion were examined by wound healing assay and invasion assay. Western blotting was used to explore the impact of ZNF143 on epithelial mesenchymal transition (EMT)-related proteins and the Wnt/β-catenin pathway. Results ·The bioinformatics database was processed to analyze key genes associated with the up-regulation of genes in lipid metabolism disorders in pancreatic cancer and liver cancer. Among them, ZNF143 was a potential gene associated with fatty acid accumulation in pancreatic cancer. In vitro experiments confirmed that the mRNA level of ZNF143 was significantly up-regulated after treating pancreatic cancer cells with palmitic acid or oleic acid. Both KEGG and GO enrichment analyses demonstrated that the differentially expressed genes associated with ZNF143 were predominantly enriched in adhesion pathways. In functional experiments, the migration and invasion abilities of pancreatic cancer cells transfected with ZNF143 siRNA were reduced, and the expression of EMT-related proteins was also decreased, potentially related to the activation of the Wnt/β- catenin pathway. Conclusion ·Fatty acid accumulation up-regulates the mRNA expression of ZNF143 in pancreatic cancer cells, and ZNF143 may enhance the migration and invasion of these cells by facilitating EMT through activation of the Wnt/β-catenin pathway.

Key words: pancreatic cancer, zinc finger protein 143 (ZNF143), fatty acid accumulation, bioinformatics analysis, epithelial mesenchymal transition (EMT)

CLC Number:

R735.9

YU Siwei, XU Ziqi, TAO Mengyu, FAN Guangjian. Mechanistic study on the promotion of pancreatic cancer progression through upregulation of ZNF143 by dysregulated fatty acid metabolism[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(10): 1255-1265.

Figures/Tables 6

Tab 1 Sequences of siRNA and qRT-PCR Primer

Target gene		Forward (5′→3′)	Reverse (5′→3′)
siRNA	Control siRNA	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT
	ZNF143 siRNA#1	GGACAUGCUACAAGAGUAATT	UUACUCUUGUAGCAUGUCCTT
	ZNF143 siRNA#2	GGAAGAAGCCAUCAGAAUATT	UAUUCUGAUGGCUUCUUCCTT
qPCR Primer	FAS	TCTGGTTCTTACGTCTGTTGC	CTGTGCAGTCCCTAGCTTTCC
	ZNF143	AAGTCCCGCAGTCTGACAC	CCTGCTACACTTTCACTTCCATC
	HNRNPA1L2	TCTAAGTCAGCGTCTCCAAAAGA	TGGCGTTGTATTCATAGCTGC

Fig 1 Screening for genes in pancreatic cancer that are affected by fatty acid disorders

Fig 2 Fatty acid accumulation up-regulates the expression of ZNF143 in pancreatic cancer

Fig 3 KEGG analysis and GO analysis of ZNF143 in TCGA database

Fig 4 Knockdown of ZNF143 inhibited the migration and invasion ability of AsPC-1 and Capan2 cells

Fig 5 Knockdown of ZNF143 down-regulated the expression of proteins related to EMT and Wnt/β-catenin pathway in AsPC-1 and Capan2 cells

TrendMD

References 35

1	HALBROOK C J, LYSSIOTIS C A, PASCA DI MAGLIANO M, et al. Pancreatic cancer: advances and challenges[J]. Cell, 2023, 186(8): 1729-1754.
2	QIAN Y Z, GONG Y T, FAN Z Y, et al. Molecular alterations and targeted therapy in pancreatic ductal adenocarcinoma[J]. J Hematol Oncol, 2020, 13(1): 130.
3	SINN M, BAHRA M, LIERSCH T, et al. CONKO-005: adjuvant chemotherapy with gemcitabine plus erlotinib versus gemcitabine alone in patients after R0 resection of pancreatic cancer: a multicenter randomized phase III trial[J]. J Clin Oncol, 2017, 35(29): 3330-3337.
4	PERKHOFER L, GOUT J, ROGER E, et al. DNA damage repair as a target in pancreatic cancer: state-of-the-art and future perspectives[J]. Gut, 2021, 70(3): 606-617.
5	ENCARNACIÓN-ROSADO J, KIMMELMAN A C. Harnessing metabolic dependencies in pancreatic cancers[J]. Nat Rev Gastroenterol Hepatol, 2021, 18(7): 482-492.
6	HALBROOK C J, THURSTON G, BOYER S, et al. Differential integrated stress response and asparagine production drive symbiosis and therapy resistance of pancreatic adenocarcinoma cells[J]. Nat Cancer, 2022, 3(11): 1386-1403.
7	YIN X P, XU R Y, SONG J L, et al. Lipid metabolism in pancreatic cancer: emerging roles and potential targets[J]. Cancer Commun, 2022, 42(12): 1234-1256.
8	MENENDEZ J A, LUPU R. Fatty acid synthase and the lipogenic phenotype in cancer pathogenesis[J]. Nat Rev Cancer, 2007, 7(10): 763-777.
9	AUCIELLO F R, BULUSU V, OON C, et al. A stromal lysolipid-autotaxin signaling axis promotes pancreatic tumor progression[J]. Cancer Discov, 2019, 9(5): 617-627.
10	BIAN X L, LIU R, MENG Y, et al. Lipid metabolism and cancer[J]. J Exp Med, 2021, 218(1): e20201606.
11	JEONG D W, PARK J W, KIM K S, et al. Palmitoylation-driven PHF2 ubiquitination remodels lipid metabolism through the SREBP1c axis in hepatocellular carcinoma[J]. Nat Commun, 2023, 14(1): 6370.
12	CHEN X M, LI L Z, LIU X H, et al. Oleic acid protects saturated fatty acid mediated lipotoxicity in hepatocytes and rat of non-alcoholic steatohepatitis[J]. Life Sci, 2018, 203: 291-304.
13	SHEN C J, CHAN R H, LIN B W, et al. Oleic acid-induced metastasis of KRAS/p53-mutant colorectal cancer relies on concurrent KRAS activation and IL-8 expression bypassing EGFR activation[J]. Theranostics, 2023, 13(13): 4650-4666.
14	KUBO M, GOTOH K, EGUCHI H, et al. Impact of CD36 on chemoresistance in pancreatic ductal adenocarcinoma[J]. Ann Surg Oncol, 2020, 27(2): 610-619.
15	YE B Y, YANG G G, LI Y M, et al. ZNF143 in chromatin looping and gene regulation[J]. Front Genet, 2020, 11: 338.
16	YE B Y, SHEN W L, ZHANG C Y, et al. The role of ZNF143 overexpression in rat liver cell proliferation[J]. BMC Genomics, 2022, 23(1): 483.
17	CHEN X, FANG F, LIOU Y C, et al. Zfp143 regulates Nanog through modulation of Oct4 binding[J]. Stem Cells, 2008, 26(11): 2759-2767.
18	MYSLINSKI E, GÉRARD M A, KROL A, et al. A genome scale location analysis of human Staf/ZNF143-binding sites suggests a widespread role for human Staf/ZNF143 in mammalian promoters[J]. J Biol Chem, 2006, 281(52): 39953-39962.
19	NGONDO R P, CARBON P. ZNF143 is regulated through alternative 3'UTR isoforms[J]. Biochimie, 2014, 104: 137-146.
20	IZUMI H, WAKASUGI T, SHIMAJIRI S, et al. Role of ZNF143 in tumor growth through transcriptional regulation of DNA replication and cell-cycle-associated genes[J]. Cancer Sci, 2010, 101(12): 2538-2545.
21	KAWATSU Y, KITADA S, URAMOTO H, et al. The combination of strong expression of ZNF143 and high MIB-1 labelling index independently predicts shorter disease-specific survival in lung adenocarcinoma[J]. Br J Cancer, 2014, 110(10): 2583-2592.
22	PAEK A R, MUN J Y, JO M J, et al. The role of ZNF143 in breast cancer cell survival through the NAD(P)H quinone dehydrogenase 1-p53-Beclin1 axis under metabolic stress[J]. Cells, 2019, 8(4): 296.
23	VERMA V, PAEK A R, CHOI B K, et al. Loss of zinc-finger protein 143 contributes to tumour progression by interleukin-8-CXCR axis in colon cancer[J]. J Cell Mol Med, 2019, 23(6): 4043-4053.
24	CARRER A, TREFELY S, ZHAO S, et al. Acetyl-CoA metabolism supports multistep pancreatic tumorigenesis[J]. Cancer Discov, 2019, 9(3): 416-435.
25	TADROS S, SHUKLA S K, KING R J, et al. De novo lipid synthesis facilitates gemcitabine resistance through endoplasmic reticulum stress in pancreatic cancer[J]. Cancer Res, 2017, 77(20): 5503-5517.
26	LI J, GU D, LEE S S, et al. Abrogating cholesterol esterification suppresses growth and metastasis of pancreatic cancer[J]. Oncogene, 2016, 35(50): 6378-6388.
27	NATH A, LI I, ROBERTS L R, et al. Elevated free fatty acid uptake via CD36 promotes epithelial-mesenchymal transition in hepatocellular carcinoma[J]. Sci Rep, 2015, 5: 14752.
28	PAN J M, FAN Z Y, WANG Z Q, et al. CD36 mediates palmitate acid-induced metastasis of gastric cancer via AKT/GSK-3β/β- catenin pathway[J]. J Exp Clin Cancer Res, 2019, 38(1): 52.
29	MARTIN-MORENO J M, WILLETT W C, GORGOJO L, et al. Dietary fat, olive oil intake and breast cancer risk[J]. Int J Cancer, 1994, 58(6): 774-780.
30	YANG P, SU C X, LUO X, et al. Dietary oleic acid-induced CD36 promotes cervical cancer cell growth and metastasis via up-regulation Src/ERK pathway[J]. Cancer Lett, 2018, 438: 76-85.
31	NEUSCHWANDER-TETRI B A. Hepatic lipotoxicity and the pathogenesis of nonalcoholic steatohepatitis: the central role of nontriglyceride fatty acid metabolites[J]. Hepatology, 2010, 52(2): 774-788.
32	HUNING L, KUNKEL G R. Two paralogous znf143 genes in zebrafish encode transcriptional activator proteins with similar functions but expressed at different levels during early development[J]. BMC Mol Cell Biol, 2020, 21(1): 3.
33	PAEK A R, LEE C H, YOU H J. A role of zinc-finger protein 143 for cancer cell migration and invasion through ZEB1 and E-cadherin in colon cancer cells[J]. Mol Carcinog, 2014, 53(Suppl 1): E161-E168.
34	FENG Y L, CHEN D Q, VAZIRI N D, et al. Small molecule inhibitors of epithelial-mesenchymal transition for the treatment of cancer and fibrosis[J]. Med Res Rev, 2020, 40(1): 54-78.
35	WEN Z, HUANG Z T, ZHANG R, et al. ZNF143 is a regulator of chromatin loop[J]. Cell Biol Toxicol, 2018, 34(6): 471-478.

[1]	DU Shaoqian, TAO Mengyu, CAO Yuan, WANG Hongxia, HU Xiaoqu, FAN Guangjian, ZANG Lijuan. CXCL9 expression in breast cancer and its correlation with the characteristics of tumor immunoinfiltration [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(7): 860-872.
[2]	QIN Yahan, ZHANG Ke, ZHANG Mengyu, SHEN Jie, PENG Meiyu. Research progress of MDSCs-targeted immunotherapy for pancreatic cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(10): 1317-1323.
[3]	MA Fangfang, QIN Jiejie, REN Lingjie, TANG Xiaomei, LIU Jia, SHI Minmin, JIANG Lingxi. Establishment of a 3D culture model in vitro of pancreatic cancer primary cells using hydrogel microspheres [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(1): 79-87.
[4]	XU Jingxuan, DU Shaoqian, CAO Yuan, WANG Hongxia, HUANG Weiyi. MMP14 expression in pancreatic cancer and its correlation with characteristics of tumor immune microenvironment [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(3): 312-322.
[5]	Jianru WANG, Guangcao PENG, Mingjun ZHU. Screening potential hub genes associated with myocardial ischemia-reperfusion injury in mice based on GEO database and bioinformatics analysis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(1): 51-62.
[6]	Jing-wei LI, Li-wen WANG, Ling-xi JIANG, Qian ZHAN, Hao CHEN, Bai-yong SHEN. Review of immunosuppressive tumor microenvironment of pancreatic cancer [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 1103-1108.
[7]	Lu-di YANG, Gao-ming WANG, Ren-hao HU, Xiao-hua JIANG, Ran CUI. Identification of core genes in pancreatic cancer progression by bioinformatics analysis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(5): 571-578.
[8]	GAO Jing-ze, WU Xia. CXCL9 mRNA in ovarian tumor tissue and its relations with prognosis and characteristics of immune microenvironment [J]. , 2020, 40(4): 457-.
[9]	ZHANG Wei-ran1, 2, LIN Xue-feng3, LI Xin2, ZHANG Hao2, WANG Meng2, SUN Wei2, HAN Xing-peng2, SUN Da-qiang1, 4. Transcriptional identification of potential biomarkers of lung adenocarcinoma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(12): 1598-1606.
[10]	LIANG Yu, JIANG Ming-jie, TIAN Ling. Advances in prostaglandin E2 reprogramming pancreatic cancer microenvironment [J]. , 2019, 39(8): 923-.
[11]	ZHANG Peng1, CHANG Zheng-yan2, YANG Lei1, XUE Song1, LIAN Feng1. Bioinformatics analysis of differentially expressed genes in ischemic cardiomyopathy [J]. , 2019, 39(7): 698-.
[12]	LI Xiao-ping, ZHANG Xiao-wei, GUO Wei-jian, et al. Expression of CD44 of patients with pancreatic cancer and its clinical significance [J]. , 2015, 35(9): 1354-.
[13]	HU Bin, SONG Shao-li. Progresses of treatment of pancreatic cancer [J]. , 2015, 35(3): 445-.
[14]	LU Yang, LU Yu-hua, ZHU Hui, et al. Effect of Oct4 and Nanog gene silencing on drug resistance of pancreatic cancer stem cells [J]. , 2014, 34(3): 289-.
[15]	WANG Yi-wei, ZHENG Lei-zhen. Advances of metformin and treatment of pancreatic cancer [J]. , 2014, 34(11): 1695-.