
Journal of Shanghai Jiao Tong University (Medical Science) ›› 2024, Vol. 44 ›› Issue (10): 1255-1265.doi: 10.3969/j.issn.1674-8115.2024.10.007
• Basic research • Previous Articles Next Articles
YU Siwei(
), XU Ziqi, TAO Mengyu, FAN Guangjian(
)
Received:2024-02-18
Accepted:2024-04-29
Online:2024-10-28
Published:2024-10-28
Contact:
FAN Guangjian
E-mail:Swei1119@163.com;gjfan@shsmu.edu.cn
CLC Number:
YU Siwei, XU Ziqi, TAO Mengyu, FAN Guangjian. Mechanistic study on the promotion of pancreatic cancer progression through upregulation of ZNF143 by dysregulated fatty acid metabolism[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(10): 1255-1265.
Add to citation manager EndNote|Ris|BibTeX
URL: https://xuebao.shsmu.edu.cn/EN/10.3969/j.issn.1674-8115.2024.10.007
| Target gene | Forward (5′→3′) | Reverse (5′→3′) | |
|---|---|---|---|
| siRNA | Control siRNA | UUCUCCGAACGUGUCACGUTT | ACGUGACACGUUCGGAGAATT |
| ZNF143 siRNA#1 | GGACAUGCUACAAGAGUAATT | UUACUCUUGUAGCAUGUCCTT | |
| ZNF143 siRNA#2 | GGAAGAAGCCAUCAGAAUATT | UAUUCUGAUGGCUUCUUCCTT | |
| qPCR Primer | FAS | TCTGGTTCTTACGTCTGTTGC | CTGTGCAGTCCCTAGCTTTCC |
| ZNF143 | AAGTCCCGCAGTCTGACAC | CCTGCTACACTTTCACTTCCATC | |
| HNRNPA1L2 | TCTAAGTCAGCGTCTCCAAAAGA | TGGCGTTGTATTCATAGCTGC | |
Tab 1 Sequences of siRNA and qRT-PCR Primer
| Target gene | Forward (5′→3′) | Reverse (5′→3′) | |
|---|---|---|---|
| siRNA | Control siRNA | UUCUCCGAACGUGUCACGUTT | ACGUGACACGUUCGGAGAATT |
| ZNF143 siRNA#1 | GGACAUGCUACAAGAGUAATT | UUACUCUUGUAGCAUGUCCTT | |
| ZNF143 siRNA#2 | GGAAGAAGCCAUCAGAAUATT | UAUUCUGAUGGCUUCUUCCTT | |
| qPCR Primer | FAS | TCTGGTTCTTACGTCTGTTGC | CTGTGCAGTCCCTAGCTTTCC |
| ZNF143 | AAGTCCCGCAGTCTGACAC | CCTGCTACACTTTCACTTCCATC | |
| HNRNPA1L2 | TCTAAGTCAGCGTCTCCAAAAGA | TGGCGTTGTATTCATAGCTGC | |
| 1 | HALBROOK C J, LYSSIOTIS C A, PASCA DI MAGLIANO M, et al. Pancreatic cancer: advances and challenges[J]. Cell, 2023, 186(8): 1729-1754. |
| 2 | QIAN Y Z, GONG Y T, FAN Z Y, et al. Molecular alterations and targeted therapy in pancreatic ductal adenocarcinoma[J]. J Hematol Oncol, 2020, 13(1): 130. |
| 3 | SINN M, BAHRA M, LIERSCH T, et al. CONKO-005: adjuvant chemotherapy with gemcitabine plus erlotinib versus gemcitabine alone in patients after R0 resection of pancreatic cancer: a multicenter randomized phase III trial[J]. J Clin Oncol, 2017, 35(29): 3330-3337. |
| 4 | PERKHOFER L, GOUT J, ROGER E, et al. DNA damage repair as a target in pancreatic cancer: state-of-the-art and future perspectives[J]. Gut, 2021, 70(3): 606-617. |
| 5 | ENCARNACIÓN-ROSADO J, KIMMELMAN A C. Harnessing metabolic dependencies in pancreatic cancers[J]. Nat Rev Gastroenterol Hepatol, 2021, 18(7): 482-492. |
| 6 | HALBROOK C J, THURSTON G, BOYER S, et al. Differential integrated stress response and asparagine production drive symbiosis and therapy resistance of pancreatic adenocarcinoma cells[J]. Nat Cancer, 2022, 3(11): 1386-1403. |
| 7 | YIN X P, XU R Y, SONG J L, et al. Lipid metabolism in pancreatic cancer: emerging roles and potential targets[J]. Cancer Commun, 2022, 42(12): 1234-1256. |
| 8 | MENENDEZ J A, LUPU R. Fatty acid synthase and the lipogenic phenotype in cancer pathogenesis[J]. Nat Rev Cancer, 2007, 7(10): 763-777. |
| 9 | AUCIELLO F R, BULUSU V, OON C, et al. A stromal lysolipid-autotaxin signaling axis promotes pancreatic tumor progression[J]. Cancer Discov, 2019, 9(5): 617-627. |
| 10 | BIAN X L, LIU R, MENG Y, et al. Lipid metabolism and cancer[J]. J Exp Med, 2021, 218(1): e20201606. |
| 11 | JEONG D W, PARK J W, KIM K S, et al. Palmitoylation-driven PHF2 ubiquitination remodels lipid metabolism through the SREBP1c axis in hepatocellular carcinoma[J]. Nat Commun, 2023, 14(1): 6370. |
| 12 | CHEN X M, LI L Z, LIU X H, et al. Oleic acid protects saturated fatty acid mediated lipotoxicity in hepatocytes and rat of non-alcoholic steatohepatitis[J]. Life Sci, 2018, 203: 291-304. |
| 13 | SHEN C J, CHAN R H, LIN B W, et al. Oleic acid-induced metastasis of KRAS/p53-mutant colorectal cancer relies on concurrent KRAS activation and IL-8 expression bypassing EGFR activation[J]. Theranostics, 2023, 13(13): 4650-4666. |
| 14 | KUBO M, GOTOH K, EGUCHI H, et al. Impact of CD36 on chemoresistance in pancreatic ductal adenocarcinoma[J]. Ann Surg Oncol, 2020, 27(2): 610-619. |
| 15 | YE B Y, YANG G G, LI Y M, et al. ZNF143 in chromatin looping and gene regulation[J]. Front Genet, 2020, 11: 338. |
| 16 | YE B Y, SHEN W L, ZHANG C Y, et al. The role of ZNF143 overexpression in rat liver cell proliferation[J]. BMC Genomics, 2022, 23(1): 483. |
| 17 | CHEN X, FANG F, LIOU Y C, et al. Zfp143 regulates Nanog through modulation of Oct4 binding[J]. Stem Cells, 2008, 26(11): 2759-2767. |
| 18 | MYSLINSKI E, GÉRARD M A, KROL A, et al. A genome scale location analysis of human Staf/ZNF143-binding sites suggests a widespread role for human Staf/ZNF143 in mammalian promoters[J]. J Biol Chem, 2006, 281(52): 39953-39962. |
| 19 | NGONDO R P, CARBON P. ZNF143 is regulated through alternative 3'UTR isoforms[J]. Biochimie, 2014, 104: 137-146. |
| 20 | IZUMI H, WAKASUGI T, SHIMAJIRI S, et al. Role of ZNF143 in tumor growth through transcriptional regulation of DNA replication and cell-cycle-associated genes[J]. Cancer Sci, 2010, 101(12): 2538-2545. |
| 21 | KAWATSU Y, KITADA S, URAMOTO H, et al. The combination of strong expression of ZNF143 and high MIB-1 labelling index independently predicts shorter disease-specific survival in lung adenocarcinoma[J]. Br J Cancer, 2014, 110(10): 2583-2592. |
| 22 | PAEK A R, MUN J Y, JO M J, et al. The role of ZNF143 in breast cancer cell survival through the NAD(P)H quinone dehydrogenase 1-p53-Beclin1 axis under metabolic stress[J]. Cells, 2019, 8(4): 296. |
| 23 | VERMA V, PAEK A R, CHOI B K, et al. Loss of zinc-finger protein 143 contributes to tumour progression by interleukin-8-CXCR axis in colon cancer[J]. J Cell Mol Med, 2019, 23(6): 4043-4053. |
| 24 | CARRER A, TREFELY S, ZHAO S, et al. Acetyl-CoA metabolism supports multistep pancreatic tumorigenesis[J]. Cancer Discov, 2019, 9(3): 416-435. |
| 25 | TADROS S, SHUKLA S K, KING R J, et al. De novo lipid synthesis facilitates gemcitabine resistance through endoplasmic reticulum stress in pancreatic cancer[J]. Cancer Res, 2017, 77(20): 5503-5517. |
| 26 | LI J, GU D, LEE S S, et al. Abrogating cholesterol esterification suppresses growth and metastasis of pancreatic cancer[J]. Oncogene, 2016, 35(50): 6378-6388. |
| 27 | NATH A, LI I, ROBERTS L R, et al. Elevated free fatty acid uptake via CD36 promotes epithelial-mesenchymal transition in hepatocellular carcinoma[J]. Sci Rep, 2015, 5: 14752. |
| 28 | PAN J M, FAN Z Y, WANG Z Q, et al. CD36 mediates palmitate acid-induced metastasis of gastric cancer via AKT/GSK-3β/β- catenin pathway[J]. J Exp Clin Cancer Res, 2019, 38(1): 52. |
| 29 | MARTIN-MORENO J M, WILLETT W C, GORGOJO L, et al. Dietary fat, olive oil intake and breast cancer risk[J]. Int J Cancer, 1994, 58(6): 774-780. |
| 30 | YANG P, SU C X, LUO X, et al. Dietary oleic acid-induced CD36 promotes cervical cancer cell growth and metastasis via up-regulation Src/ERK pathway[J]. Cancer Lett, 2018, 438: 76-85. |
| 31 | NEUSCHWANDER-TETRI B A. Hepatic lipotoxicity and the pathogenesis of nonalcoholic steatohepatitis: the central role of nontriglyceride fatty acid metabolites[J]. Hepatology, 2010, 52(2): 774-788. |
| 32 | HUNING L, KUNKEL G R. Two paralogous znf143 genes in zebrafish encode transcriptional activator proteins with similar functions but expressed at different levels during early development[J]. BMC Mol Cell Biol, 2020, 21(1): 3. |
| 33 | PAEK A R, LEE C H, YOU H J. A role of zinc-finger protein 143 for cancer cell migration and invasion through ZEB1 and E-cadherin in colon cancer cells[J]. Mol Carcinog, 2014, 53(Suppl 1): E161-E168. |
| 34 | FENG Y L, CHEN D Q, VAZIRI N D, et al. Small molecule inhibitors of epithelial-mesenchymal transition for the treatment of cancer and fibrosis[J]. Med Res Rev, 2020, 40(1): 54-78. |
| 35 | WEN Z, HUANG Z T, ZHANG R, et al. ZNF143 is a regulator of chromatin loop[J]. Cell Biol Toxicol, 2018, 34(6): 471-478. |
| [1] | Wang Yiran, Zhang Zhe, Shen Jianfeng. Comprehensive analysis of the function, prognosis, and immune infiltration characteristics of SF3B1 mutations in uveal melanoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(4): 475-485. |
| [2] | SUN Chenwei, HAI Wangxi, QU Qian, XI Yun. [18F]F-FMISO and [18F]F-FLT PET/CT dual-nuclide imaging for in vivo prediction of drug resistance in pancreatic cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(1): 60-68. |
| [3] | DU Shaoqian, TAO Mengyu, CAO Yuan, WANG Hongxia, HU Xiaoqu, FAN Guangjian, ZANG Lijuan. CXCL9 expression in breast cancer and its correlation with the characteristics of tumor immunoinfiltration [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(7): 860-872. |
| [4] | QIN Yahan, ZHANG Ke, ZHANG Mengyu, SHEN Jie, PENG Meiyu. Research progress of MDSCs-targeted immunotherapy for pancreatic cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(10): 1317-1323. |
| [5] | MA Fangfang, QIN Jiejie, REN Lingjie, TANG Xiaomei, LIU Jia, SHI Minmin, JIANG Lingxi. Establishment of a 3D culture model in vitro of pancreatic cancer primary cells using hydrogel microspheres [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(1): 79-87. |
| [6] | XU Jingxuan, DU Shaoqian, CAO Yuan, WANG Hongxia, HUANG Weiyi. MMP14 expression in pancreatic cancer and its correlation with characteristics of tumor immune microenvironment [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(3): 312-322. |
| [7] | Jianru WANG, Guangcao PENG, Mingjun ZHU. Screening potential hub genes associated with myocardial ischemia-reperfusion injury in mice based on GEO database and bioinformatics analysis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(1): 51-62. |
| [8] | Jing-wei LI, Li-wen WANG, Ling-xi JIANG, Qian ZHAN, Hao CHEN, Bai-yong SHEN. Review of immunosuppressive tumor microenvironment of pancreatic cancer [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 1103-1108. |
| [9] | Lu-di YANG, Gao-ming WANG, Ren-hao HU, Xiao-hua JIANG, Ran CUI. Identification of core genes in pancreatic cancer progression by bioinformatics analysis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(5): 571-578. |
| [10] | GAO Jing-ze, WU Xia. CXCL9 mRNA in ovarian tumor tissue and its relations with prognosis and characteristics of immune microenvironment [J]. , 2020, 40(4): 457-. |
| [11] | ZHANG Wei-ran1, 2, LIN Xue-feng3, LI Xin2, ZHANG Hao2, WANG Meng2, SUN Wei2, HAN Xing-peng2, SUN Da-qiang1, 4. Transcriptional identification of potential biomarkers of lung adenocarcinoma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(12): 1598-1606. |
| [12] | LIANG Yu, JIANG Ming-jie, TIAN Ling. Advances in prostaglandin E2 reprogramming pancreatic cancer microenvironment [J]. , 2019, 39(8): 923-. |
| [13] | ZHANG Peng1, CHANG Zheng-yan2, YANG Lei1, XUE Song1, LIAN Feng1. Bioinformatics analysis of differentially expressed genes in ischemic cardiomyopathy [J]. , 2019, 39(7): 698-. |
| [14] | LI Xiao-ping, ZHANG Xiao-wei, GUO Wei-jian, et al. Expression of CD44 of patients with pancreatic cancer and its clinical significance [J]. , 2015, 35(9): 1354-. |
| [15] | HU Bin, SONG Shao-li. Progresses of treatment of pancreatic cancer [J]. , 2015, 35(3): 445-. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||