Study on the effects of spermidine on LPS-induced inflammatory osteolysis in mouse calvaria

doi:10.3969/j.issn.1674-8115.2025.06.002

Abstract

Abstract:

Objective ·To investigate the inhibitory effects of spermidine (SPD) on inflammatory osteolysis both in vivo and in vitro. Methods ·The CCK-8 assay was used to assess the viability of RAW264.7 macrophages treated with various concentrations of SPD. The levels of intracellular reactive oxygen species (ROS) in lipopolysaccharide (LPS)-activated RAW264.7 cells were evaluated by staining with dichlorodihydrofluorescein diacetate (DCFH-DA) and dihydroethidium (DHE), respectively. Reverse transcription real-time fluorescence quantitative PCR (RT-qPCR) was utilized to determine the effects of SPD on the expression of pro-inflammatory genes in LPS-activated RAW264.7 cells. Tartrate-resistant acid phosphatase (TRAP) staining was used to evaluate the effect of SPD on the differentiation of mouse primary bone marrow-derived macrophages (BMMs) into osteoclasts. RT-qPCR was employed to further analyze the effect of SPD on the expression of genes related to osteoclast differentiation and functions after BMM-induced differentiation. An LPS-induced mouse calvarial osteolysis model was constructed, and the therapeutic efficacy of SPD on inflammatory osteolysis was assessed using Micro-CT analysis, hematoxylin-eosin (H-E) staining and TRAP staining of histological sections. Results ·The CCK-8 assay showed that SPD, even at a concentration of 1 000 μmol/L, exhibited no significant cytotoxicity to RAW264.7 cells. ROS analysis revealed that SPD markedly inhibited LPS-induced elevation of intracellular ROS levels in macrophages. RT-qPCR results indicated that SPD suppressed the expression of pro-inflammatory genes induced by LPS. Both TRAP staining and RT-qPCR demonstrated that SPD effectively inhibited the differentiation of BMMs into osteoclasts induced by receptor activator of nuclear factor-κB ligand (RANKL) and reduced the expression of genes associated with osteoclast differentiation and function. In the mouse calvarial osteolysis model, Micro-CT analysis showed that the bone volume fraction and bone mineral density in the SPD-treated groups were significantly higher than those in the LPS group. Histological staining revealed that SPD treatment reduced inflammatory cell infiltration, decreased osteoclast numbers, and alleviated tissue damage. Conclusion ·SPD inhibits macrophage inflammatory responses and RANKL-induced osteoclast differentiation in vitro; in vivo, it alleviates LPS-induced inflammatory calvarial osteolysis in mice.

Key words: spermidine (SPD), osteolysis, osteoclast, inflammation

CLC Number:

R364.5

ZHAO Xinyu, ZHANG Wenchao, CHEN Xuzhuo, SONG Jiaqi, HUANG Hui, ZHANG Shanyong. Study on the effects of spermidine on LPS-induced inflammatory osteolysis in mouse calvaria[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(6): 673-683.

Figures/Tables 8

Tab 1 qPCR primer sequences

Gene	Forward primer (5'→3')	Reverse primer (5'→3')
Gapdh	TGGAGCCAAAAGGGTCATCA	ATGAGCCCTTCCACAATGCC
Trap	CAAAGAGATCGCCAGAACCG	GAGACGTTGCCAAGGTGATC
Ctsk	CTTCCAATACGTGCAGCAGA	TCTTCAGGGCTTTCTCGTTC
Ctr	TGCAGACAACTCTTGGTTGG	TCGGTTTCTTCTCCTCTGGA
Dcstamp	TTGAACCGAGCTGCATTCCT	GTTTCCCGTCAGCCTCTCTC
Il6	TGCCTTCTTGGGACTGAT	CTGGCTTTGTCTTTCTTGTT
Tnf	TTAGAAAGGGGATTATGGCTCA	TTTGCAGAACTCAGGAATGGAC
Nos2	CGTTCCTGGAGGTGCTTGA	TCTCGGGTGCGGTAGGTG

Fig 1 Cytotoxicity of different concentrations of SPD on RAW264.7 cells detected by CCK-8 assay

Fig 2 Effects of SPD on ROS levels in LPS-activated macrophages

Fig 3 Effects of SPD on expression levels of pro-inflammatory genes in LPS-activated macrophages

Fig 4 Effects of SPD on RANKL-induced osteoclast differentiation

Fig 5 Effects of SPD on the expression of osteoclast-related genes in BMMs after 24 h of RANKL stimulation

Fig 6 Micro-CT analysis of therapeutic effects of SPD on mouse calvarial osteolysis

Fig 7 Histological analysis of therapeutic effects of SPD on mouse calvarial osteolysis

TrendMD

References 31

[1]	ZAIDI M. Skeletal remodeling in health and disease[J]. Nat Med, 2007, 13(7): 791-801.
[2]	ZOU W, TEITELBAUM S L. Absence of Dap12 and the αvβ3 integrin causes severe osteopetrosis[J]. J Cell Biol, 2015, 208(1): 125-136.
[3]	LIU K W, WANG Z H, LIU J B, et al. Atsttrin regulates osteoblastogenesis and osteoclastogenesis through the TNFR pathway[J]. Commun Biol, 2023, 6(1): 1251.
[4]	TSUKASAKI M, TAKAYANAGI H. Osteoimmunology: evolving concepts in bone-immune interactions in health and disease[J]. Nat Rev Immunol, 2019, 19(10): 626-642.
[5]	ZOFKOVA I, BLAHOS J. New molecules modulating bone metabolism: new perspectives in the treatment of osteoporosis[J]. Physiol Res, 2017, 66(Suppl 3): S341-S347.
[6]	QUINN J M W, SALEH H. Modulation of osteoclast function in bone by the immune system[J]. Mol Cell Endocrinol, 2009, 310(1/2): 40-51.
[7]	LEE S K, LORENZO J. Cytokines regulating osteoclast formation and function[J]. Curr Opin Rheumatol, 2006, 18(4): 411-418.
[8]	GRUBER R. Osteoimmunology: inflammatory osteolysis and regeneration of the alveolar bone[J]. J Clin Periodontol, 2019, 46(Suppl 21): 52-69.
[9]	ROSSA C, EHMANN K, LIU M, et al. MKK3/6-p38 MAPK signaling is required for IL-1β and TNF-α-induced RANKL expression in bone marrow stromal cells[J]. J Interferon Cytokine Res, 2006, 26(10): 719-729.
[10]	OKAMOTO A, SUGI E, KOIZUMI Y, et al. Polyamine content of ordinary foodstuffs and various fermented foods[J]. Biosci Biotechnol Biochem, 1997, 61(9): 1582-1584.
[11]	ALI M A, POORTVLIET E, STRÖMBERG R, et al. Polyamines: total daily intake in adolescents compared to the intake estimated from the Swedish Nutrition Recommendations Objectified (SNO)[J]. Food Nutr Res, 2011, 55: 55.
[12]	MADEO F, EISENBERG T, PIETROCOLA F, et al. Spermidine in health and disease[J]. Science, 2018, 359(6374): eaan2788.
[13]	YUAN H, WU S X, ZHOU Y F, et al. Spermidine inhibits joints inflammation and macrophage activation in mice with collagen-induced arthritis[J]. J Inflamm Res, 2021, 14: 2713-2721.
[14]	IEZAKI T, HINOI E, YAMAMOTO T, et al. Amelioration by the natural polyamine spermine of cartilage and bone destruction in rats with collagen-induced arthritis[J]. J Pharmacol Sci, 2012, 119(1): 107-111.
[15]	TSUJINAKA S, SODA K, KANO Y, et al. Spermine accelerates hypoxia-initiated cancer cell migration[J]. Int J Oncol, 2011, 38(2): 305-312.
[16]	TODA G, YAMAUCHI T, KADOWAKI T, et al. Preparation and culture of bone marrow-derived macrophages from mice for functional analysis[J]. STAR Protoc, 2021, 2(1): 100246.
[17]	ZHANG J, ZHU L, PENG B. Effect of BioAggregate on osteoclast differentiation and inflammatory bone resorption in vivo[J]. Int Endod J, 2015, 48(11): 1077-1085.
[18]	FENG X, MCDONALD J M. Disorders of bone remodeling[J]. Annu Rev Pathol Mech Dis, 2011, 6: 121-145.
[19]	GU Q L, YANG H L, SHI Q. Macrophages and bone inflammation[J]. J Orthop Translat, 2017, 10: 86-93.
[20]	LIU R, LI X L, MA H, et al. Spermidine endows macrophages anti-inflammatory properties by inducing mitochondrial superoxide-dependent AMPK activation, Hif-1α upregulation and autophagy[J]. Free Radic Biol Med, 2020, 161: 339-350.
[21]	KHONGKARAT P, PHUWAPRAISIRISAN P, CHANCHAO C P. Phytochemical content, especially spermidine derivatives, presenting antioxidant and antilipoxygenase activities in Thai bee pollens[J]. PeerJ, 2022, 10: e13506.
[22]	FAN J J, FENG Z Y, CHEN N. Spermidine as a target for cancer therapy[J]. Pharmacol Res, 2020, 159: 104943.
[23]	XU T T, LI H, DAI Z, et al. Spermidine and spermine delay brain aging by inducing autophagy in SAMP8 mice[J]. Aging (Albany NY), 2020, 12(7): 6401-6414.
[24]	MIZUKAMI J, TAKAESU G, AKATSUKA H, et al. Receptor activator of NF-κB ligand (RANKL) activates TAK1 mitogen-activated protein kinase kinase kinase through a signaling complex containing RANK, TAB2, and TRAF6[J]. Mol Cell Biol, 2002, 22(4): 992-1000.
[25]	FUJIWARA T, ZHOU J, YE S, et al. RNA-binding protein Musashi2 induced by RANKL is critical for osteoclast survival[J]. Cell Death Dis, 2016, 7(7): e2300.
[26]	THOMAS D C. The phagocyte respiratory burst: historical perspectives and recent advances[J]. Immunol Lett, 2017, 192: 88-96.
[27]	GE X H, TANG P Y, RONG Y L, et al. Exosomal miR-155 from M1-polarized macrophages promotes EndoMT and impairs mitochondrial function via activating NF-κB signaling pathway in vascular endothelial cells after traumatic spinal cord injury[J]. Redox Biol, 2021, 41: 101932.
[28]	YANG Z, MIN Z J, YU B. Reactive oxygen species and immune regulation[J]. Int Rev Immunol, 2020, 39(6): 292-298.
[29]	ZENGER S, HE W T, EK-RYLANDER B, et al. Differential expression of tartrate-resistant acid phosphatase isoforms 5a and 5b by tumor and stromal cells in human metastatic bone disease[J]. Clin Exp Metastasis, 2011, 28(1): 65-73.
[30]	GAI D Z, CHEN J R, STEWART J P, et al. CST6 suppresses osteolytic bone disease in multiple myeloma by blocking osteoclast differentiation[J]. J Clin Invest, 2022, 132(18): e159527.
[31]	AKIRA S, TAKEDA K, KAISHO T. Toll-like receptors: critical proteins linking innate and acquired immunity[J]. Nat Immunol, 2001, 2(8): 675-680.