Adeno-associated virus serotype 8-mediated gene therapy in Gjb2 mutant c.109G>A homozygous mice

doi:10.3969/j.issn.1674-8115.2022.06.007

Abstract

Abstract: Objective

·To determine the expression and safety of the wild-type gap junction protein β 2 (Gjb2) gene delivered by adeno-associated virus serotype 8 (AAV8) into cochlear supporting cell region, and its effect on furosemide-induced hearing loss in Gjb2 mutant c.109G>A homozygous mice (Gjb2 homozygous mice).

Methods

·The AAV8-GFP viruses with green fluorescent protein (GFP) were injected into the inner ears of newborn Gjb2 homozygous mice through the cochlear scala media, and the GFP expression in the basilar membrane was evaluated by fluorescence microscope 14 d after injection. AAV8-GJB2-GFP viruses with wild-type Gjb2 gene were injected into the inner ears of neonatal Gjb2 homozygous mice, and then the Gjb2 mRNA and its encoded protein connexin 26 (CX26) expression level and location in the cochleae were detected by RT-qPCR, Western blotting and immunofluorescence. The auditory brainstem response (ABR) test was performed to evaluate the hearing thresholds at 5.66?45.00 kHz of the 4-week-old homozygous mice, which were injected with AAV8-GJB2-GFP at the neonatal stage. The furosemide test was used to compare the changes of ABR thresholds before and after intraperitoneal injection in wild-type mice and Gjb2 homozygous mice, and observe whether furosemide-induced hearing loss could be alleviated by AAV8-GJB2-GFP injection in the homozygous mice.

Results

·Fourteen days after AAV8-GFP injection, the transfection rates of supporting cells in the apex, middle, and basal turns of the cochleae were (11.60±1.28)%, (10.33±1.55)%, and (5.40±0.86)%. Four weeks after AAV8-GJB2-GFP injection, the Gjb2 mRNA expression level was 26% higher than that in the uninjected side, and CX26 protein level was 31% higher than that in the uninjected side. The expression of CX26 protein was observed in the supporting cells and ectopic expression of CX26 was also observed between the inner hair cells by using fluorescent microscope. The ABR thresholds did not shift after AAV8-GJB2-GFP injection, indicating its safety. Gjb2 homozygous mice exhibited worse hearing loss than wild-type mice after furosemide injection, whereas AAV8-GJB2-GFP alleviated furosemide-induced hearing loss in Gjb2 homozygous mice, and the thresholds measured at 8.00, 11.32 and 16.00 kHz were significantly different between the treated mice and the untreated ones (P<0.05).

Conclusion

·The injection of AAV8-GJB2-GFP into the scala media of neonatal Gjb2 homozygous mice can make the cochlear supporting cells express exogenous Gjb2 in the adulthood, which alleviate the furosemide-induced hearing loss.

Key words: adeno-associated virus (AAV), gap junction protein beta 2 (Gjb2), supporting cell, furosemide, gene therapy

CLC Number:

R764.43

CHENG Zhenzhe, JIN Chenxi, FENG Baoyi, ZHENG Xiaofei, LIU Yiqing, WU Hao, TAO Yong. Adeno-associated virus serotype 8-mediated gene therapy in Gjb2 mutant c.109G>A homozygous mice[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(6): 735-741.

Figures/Tables 6

Tab 1 Primer sequences for real-time qPCR

Name	Sequence（5’→3’）
Gjb2-Forward	ATCCTCGGGGGTGTCAACAA
Gjb2-Reverse	AGACAAAATCGGCTTGCTCATC
Gjb6-Forward	ACCAGCATAGGGAAGGTGTG
Gjb6-Reverse	TGCAGAGTGTTGCAGACAAAG
Rpl19-Forward	ACCTGGATGAGAAGGATGAG
Rpl19-Reverse	ACCTTCAGGTACAGGCTGTG

Fig 1 Supporting cells transfection 14 d after AAV8-GFP injection in the scala media of the cochleae of Gjb2 homozygous mice

Fig 2 Expression and location of Gjb2 and it's expression protein CX26 in the cochleae of Gjb2 homozygous mice 4 weeks after AAV8-GJB2-GFP injection in the scala media

Fig 3 Comparison of ABR thresholds between AAV8-GJB2-GFP injected side and contralateral side of cochleae after 4 weeks in Gjb2 homozygous mice

Fig 4 Changes of ABR thresholds before and after furosemide injection in 4-week-old wild type mice and Gjb2 homozygous mice

Fig 5 Changes of ABR thresholds in furosemide test in the Gjb2 homozygous mice 4 weeks after AAV8-GJB2-GFP injection

TrendMD

References 25

1	MARAZITA M L, PLOUGHMAN L M, RAWLINGS B, et al. Genetic epidemiological studies of early-onset deafness in the US school-age population[J]. Am J Med Genet, 1993, 46(5): 486-491.
2	MORTON C C, NANCE W E. Newborn hearing screening: a silent revolution[J]. N Engl J Med, 2006, 354(20): 2151-2164.
3	KELSELL D P, DUNLOP J, STEVENS H P, et al. Connexin 26 mutations in hereditary non-syndromic sensorineural deafness[J]. Nature, 1997, 387(6628): 80-83.
4	KELLEY P M, HARRIS D J, COMER B C, et al. Novel mutations in the connexin 26 gene (GJB2) that cause autosomal recessive (DFNB1) hearing loss[J]. Am J Hum Genet, 1998, 62(4): 792-799.
5	JAGGER D J, FORGE A. Connexins and gap junctions in the inner ear: it's not just about K⁺ recycling[J]. Cell Tissue Res, 2015, 360(3): 633-644.
6	SANTOS-SACCHI J, DALLOS P. Intercellular communication in the supporting cells of the organ of Corti[J]. Hear Res, 1983, 9(3): 317-326.
7	KIKUCHI T, KIMURA R S, PAUL D L, et al. Gap junctions in the rat cochlea: immunohistochemical and ultrastructural analysis[J]. Anat Embryol (Berl), 1995, 191(2): 101-118.
8	WANG Y F, CHANG Q, TANG W X, et al. Targeted connexin26 ablation arrests postnatal development of the organ of Corti[J]. Biochem Biophys Res Commun, 2009, 385(1): 33-37.
9	MEI L, CHEN J, ZONG L, et al. A deafness mechanism of digenic Cx26 (GJB2) and Cx30 (GJB6) mutations: reduction of endocochlear potential by impairment of heterogeneous gap junctional function in the cochlear lateral wall[J]. Neurobiol Dis, 2017, 108: 195-203.
10	AKIL O, SEAL R P, BURKE K, et al. Restoration of hearing in the Vglut3 knockout mouse using virally mediated gene therapy[J]. Neuron, 2012, 75(2): 283-293.
11	ASKEW C, ROCHAT C, PAN B F, et al. Tmc gene therapy restores auditory function in deaf mice[J]. Sci Transl Med, 2015, 7(295): 295ra108.
12	GYÖRGY B, MEIJER E J, IVANCHENKO M V, et al. Gene transfer with AAV9-PHP.B rescues hearing in a mouse model of usher syndrome 3A and transduces hair cells in a non-human primate[J]. Mol Ther Methods Clin Dev, 2018, 13: 1-13.
13	YU Q, WANG Y, CHANG Q, et al. Virally expressed connexin26 restores gap junction function in the cochlea of conditional Gjb2 knockout mice[J]. Gene Ther, 2014, 21(1): 71-80.
14	IIZUKA T, KAMIYA K, GOTOH S, et al. Perinatal Gjb2 gene transfer rescues hearing in a mouse model of hereditary deafness[J]. Hum Mol Genet, 2015, 24(13): 3651-3661.
15	CHEN Y, HU L X, WANG X L, et al. Characterization of a knock-in mouse model of the homozygous p.V37I variant in Gjb2[J]. Sci Rep, 2016, 6: 33279.
16	YUAN Y Y, YOU Y W, HUANG D L, et al. Comprehensive molecular etiology analysis of nonsyndromic hearing impairment from typical areas in China[J]. J Transl Med, 2009, 7: 79.
17	LI L, LU J R, TAO Z, et al. The p.V37I exclusive genotype of GJB2: a genetic risk-indicator of postnatal permanent childhood hearing impairment[J]. PLoS One, 2012, 7(5): e36621.
18	LIN X, LI G, ZHANG Y, et al. Hearing consequences in Gjb2 knock-in mice: implications for human p.V37I mutation[J]. Aging, 2019, 11(18): 7416-7441.
19	TAKADA Y, BEYER L A, SWIDERSKI D L, et al. Connexin 26 null mice exhibit spiral ganglion degeneration that can be blocked by BDNF gene therapy[J]. Hear Res, 2014, 309: 124-135.
20	HUANG S S, HUANG B Q, WANG G J, et al. The relationship between the p.V37I mutation in GJB2 and hearing phenotypes in Chinese individuals[J]. PloS One, 2015, 10(6): e0129662.
21	GUO J Y, MA X B, SKIDMORE J M, et al. GJB2 gene therapy and conditional deletion reveal developmental stage-dependent effects on inner ear structure and function[J]. Mol Ther Methods Clin Dev, 2021, 23: 319-333.
22	KANG W, ZHAO X L, SUN Z E, et al. Adeno-associated virus vector enables safe and efficient Cas9 activation in neonatal and adult Cas9 knockin murine cochleae[J]. Gene Ther, 2020, 27(7/8): 392-405.
23	ZHAO X L, JIN C X, DONG T T, et al. Characterization of promoters for adeno-associated virus mediated efficient Cas9 activation in adult Cas9 knock-in murine cochleae[J]. Hear Res, 2020, 394: 107999.
24	LI C W, SAMULSKI R J. Engineering adeno-associated virus vectors for gene therapy[J]. Nat Rev Genet, 2020, 21(4): 255-272.
25	DING D L, LIU H, QI W D, et al. Ototoxic effects and mechanisms of loop diuretics[J]. J Otol, 2016, 11(4): 145-156.

[1]	LI Song1, ZHONG Chang-ming1, WANG Xiao-wen1, 2, ZHANG Cheng1, 3, FENG Bo2, XIE Xiao4, HUANG Chun1, XIANG Xiao-yong1. Improved efficiency of adeno-associated virus mediated gene transfer to vein graftsof pluronic F-127-trypsin gel [J]. , 2019, 39(7): 730-.
[2]	XIAO Mei-chun, WANG Xiao-han, WANG Feng-hua . Function and application of soluble vascular endothelial growth factor receptor-1 in age-related macular degeneration#br# [J]. , 2017, 37(9): 1297-.
[3]	CHEN Ya-jing, LIU Jian-rong, YANG Guo-yuan. Research progresses of exosomes for diagnosis and treatment of central nervous system diseases [J]. , 2015, 35(11): 1727-.
[4]	WU Hai-fei, LIU Shuai, PAN Yu, et al. Experiment research on baculovirus-mediated sodium-iodine symporter gene radiotherapy for liver cancer [J]. , 2012, 32(5): 560-.
[5]	ZHANG Xia, JIN Hui-min. Research progress of vascular endothelial function in chronic kidney disease [J]. , 2012, 32(4): 528-.
[6]	PAN Yu, ZHANG Yi-fan. Application of radionuclide reporter gene imaging in therapeutic gene monitoring [J]. , 2012, 32(11): 1512-.
[7]	YAO Yu-ting, QIAN Guan-xiang, GE Sheng-fang. Impact of oncolytic viruses in combination with radiotherapy on tumor cells [J]. , 2011, 31(6): 848-.
[8]	TIAN Jing, WANG Feng, XUE Jin-feng, et al. Recombinant adeno-associated virus 2-mediated gene therapy for β-thalassemia [J]. , 2011, 31(1): 9-.
[9]	CHEN Xiao-peng, HU Liang-he, WANG Yong. Construction, identification and functional analysis of eucaryotic cell expression vector modulated by human heparanase gene promoter [J]. , 2010, 30(3): 314-.
[10]	BI Yong-yan, PAN Dong-chao, FENG Dong-fu, et al. Construction of mouse pLVX-Wnt3a-IRES-ZsGreen1 lentivirus vectors and transfection of neural stem cells [J]. , 2010, 30(12): 1455-.