Anticancer effect of drug-loaded DNA nanoflowers on mouse lung cancer cells

doi:10.3969/j.issn.1674-8115.2022.11.004

Abstract

Abstract:

Objective ·To investigate the anti-cancer effects of DNA nanoflowers (DF) loaded with horseradish peroxidase (HRP) and doxorubicin (DOX) on mice Lewis lung carcinoma (LLC) cells. Methods ·The DF loaded with HRP (HRP-DF) was synthesized by rolling circle amplification (RCA) reaction and DOX was loaded to prepare DOX/HRP-DF, the physical properties of which were detected by scanning electron microscopy and laser particle sizer. In vitro drug release capacity of DOX/HRP-DF was tested with acid buffer solution. The safety of DOX/HRP-DF was evaluated by CCK-8 assay to detect the cytotoxicity of 16HBE cells treated with DOX/HRP-DF and free DOX at different time points. Under anoxic conditions, the oxygen production capacity of DOX/HRP-DF in LLC cells was detected by using the oxygen-sensitive probe, and the effects of different dosages of free DOX, DOX-DF and DOX/HRP-DF on the proliferation capacity of LLC cells were examined by CCK-8 assay. The effects of DOX/HRP-DF on the migration and invasion of LLC cells were detected by scratching assay and Transwell assay in the experimental group treated with different dosages of DOX/HRP-DF and the control group treated with Phosphate Buffered Saline (PBS). Results ·DOX/HRP-DF were successfully prepared and observed as flower-like structures under scanning electron microscopy with uniform size. The average diameter and potential of DOX/HRP-DF were (415.90±9.32) nm and (-17.43±1.20) mV, respectively. DOX/HRP-DF had a DOX loading of (38.19±0.39)% with good pH-sensitive drug release properties. DOX/HRP-DF could significantly reduce the toxic effect of DOX on human normal cells. The results of Laser confocal microscopy showed that DOX/HRP-DF could effectively alleviate the hypoxic condition of LLC cells. CCK-8 assay results showed that the proliferation rate of LLC cells in the DOX/HRP-DF group was significantly lower in a dose-dependent manner, compared to the free DOX and DOX-DF groups (P<0.05). The results of scratching assay showed that the scratch healing rate of the DOX/HRP-DF group was lower than that of PBS group in a dose-dependent manner (P<0.05). Transwell experiments showed the number of LLC cells passing through Matrigel gel in the DOX/HRP-DF group was reduced in a dose-dependent manner, compared with the PBS group (P<0.05). Conclusion ·The successfully prepared DOX/HRP-DF could effectively deliver drugs, and alleviate hypoxia in the tumor microenvironment, and significantly inhibit the proliferation, migration and invasion ability of LLC cells, which is expected to provide new ideas for lung cancer treatment.

Key words: DNA nanoflower (DF), lung cancer, tumor inhibition, hypoxia

CLC Number:

R734.2

LIAO Hongjian, CAO Yuchao, DU Yonghong. Anticancer effect of drug-loaded DNA nanoflowers on mouse lung cancer cells[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(11): 1542-1549.

Figures/Tables 8

Tab 1 Sequence of oligonucleotides

Sample	Sequence （5′→3′）
Template	TAGCACGGACAAAAAGTAATGTTGGCCATACAAGACCGTTAAAAATGTCATTGCCTTTC
Primer	TTGTCCGTGCTAGAAAGGCAATGACAT

Fig 1 Physical characterization of DF

Fig 2 Catalytic activity assay of HRP-DF

Fig 3 DOX loading and release characteristics of DOX/HRP-DF

Fig 4 Security testing of DOX/HRP-DF

Fig 5 Detection the oxygen production capacity of DOX/HRP-DF

Fig 6 Cell viability of LLC cells after treatment with free DOX, DOX-DF and DOX/HRP-DF, respectively

Fig 7 Effects of DOX/HRP-DF of different concentrations on the migration and invasion of LLC cells

TrendMD

References 19

1	WOOD S L, PERNEMALM M, CROSBIE P A, et al. The role of the tumor-microenvironment in lung cancer-metastasis and its relationship to potential therapeutic targets[J]. Cancer Treat Rev, 2014, 40(4): 558-566.
2	LUO R J, LI Y, HE M, et al. Distinct biodistribution of doxorubicin and the altered dispositions mediated by different liposomal formulations[J]. Int J Pharm, 2017, 519(1/2): 1-10.
3	HERBST R S, MORGENSZTERN D, BOSHOFF C. The biology and management of non-small cell lung cancer[J]. Nature, 2018, 553(7689): 446-454.
4	SHENDE P, KASTURE P, GAUD R S. Nanoflowers: the future trend of nanotechnology for multi-applications[J]. Artif Cells Nanomed Biotechnol, 2018, 46(sup1): 413-422.
5	MEI L, ZHU G Z, QIU L P, et al. Self-assembled multifunctional DNA nanoflowers for the circumvention of multidrug resistance in targeted anticancer drug delivery[J]. Nano Res, 2015, 8(11): 3447-3460.
6	MICHIELS C, TELLIER C, FERON O. Cycling hypoxia: a key feature of the tumor microenvironment[J]. Biochim Biophys Acta, 2016, 1866(1): 76-86.
7	NAKAZAWA M S, KEITH B, SIMON M C. Oxygen availability and metabolic adaptations[J]. Nat Rev Cancer, 2016, 16(10): 663-673.
8	JAHANBAN-ESFAHLAN R, DE LA GUARDIA M, AHMADI D, et al. Modulating tumor hypoxia by nanomedicine for effective cancer therapy[J]. J Cell Physiol, 2018, 233(3): 2019-2031.
9	CHEN Q, LIANG C, SUN X Q, et al. H₂O₂-responsive liposomal nanoprobe for photoacoustic inflammation imaging and tumor theranostics via in vivo chromogenic assay[J]. Proc Natl Acad Sci USA, 2017, 114(21): 5343-5348.
10	GHOSH S, JAVIA A, SHETTY S, et al. Triple negative breast cancer and non-small cell lung cancer: clinical challenges and nano-formulation approaches[J]. J Control Release, 2021, 337: 27-58.
11	DHIMAN N, AWASTHI R, SHARMA B, et al. Lipid nanoparticles as carriers for bioactive delivery[J]. Front Chem, 2021, 9: 580118.
12	LV J, DONG Y, GU Z, et al. Programmable DNA nanoflowers for biosensing, bioimaging, and therapeutics[J]. Chemistry, 2020, 26(64): 14512-14524.
13	YAN Y C, LI J, LI W H, et al. DNA flower-encapsulated horseradish peroxidase with enhanced biocatalytic activity synthesized by an isothermal one-pot method based on rolling circle amplification[J]. Nanoscale, 2018, 10(47): 22456-22465.
14	PAN M, JIANG Q Y, SUN J L, et al. Programming DNA nanoassembly for enhanced photodynamic therapy[J]. Angew Chem Int Ed Engl, 2020, 59(5): 1897-1905.
15	ZHANG K X, LIU J J, SONG Q L, et al. DNA nanosponge for adsorption and clearance of intracellular miR-21 and enhanced antitumor chemotherapy[J]. ACS Appl Mater Interfaces, 2019, 11(50): 46604-46613.
16	JING X M, YANG F M, SHAO C C, et al. Role of hypoxia in cancer therapy by regulating the tumor microenvironment[J]. Mol Cancer, 2019, 18(1): 157.
17	PARK J H, MOON M, KIM J S, et al. TOPK mediates hypoxia-induced epithelial-mesenchymal transition and the invasion of nonsmall-cell lung cancer cells via the HIF-1α/snail axis[J]. Biochem Biophys Res Commun, 2021, 534: 941-949.
18	FANG J, NAKAMURA H, MAEDA H. The EPR effect: unique features of tumor blood vessels for drug delivery, factors involved, and limitations and augmentation of the effect[J]. Adv Drug Deliv Rev, 2011, 63(3): 136-151.
19	KIM E, ZWI-DANTSIS L, REZNIKOV N, et al. One-pot synthesis of multiple protein-encapsulated DNA flowers and their application in intracellular protein delivery[J]. Adv Mater, 2017, 29(26): 10.1002/adma.201701086.

[1]	ZHAO Keke, JIANG Beibei, ZHANG Lu, WANG Lingyun, ZHANG Yaping, XIE Xueqian. Feasibility of ultra-low-dose noncontrast CT based on deep learning image reconstruction to evaluate chest lesions [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(8): 1062-1069.
[2]	LIAO Yahui, LIU Liyun, ZHU Hongrui, LIN Houwen, YAN Jizhou, SUN Fan. Marine sponge-derived smenospongine overcomes resistance of cisplatin via inhibiting EGFR-Akt-ABCG2 pathway in NSCLC cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(8): 997-1007.
[3]	LIU Ziyang, WANG Xiaowen, CHEN Li. lncRNA GK-IT1 influences the carcinogenesis of non-small cell lung cancer cells through regulating aldolase A [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 591-601.
[4]	LU Wenqing, MENG Zhouwenli, YU Yongfeng, LU Shun. Resistance mechanisms and overcoming strategies of the third-generation EGFR-TKI in non-small cell lung cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(4): 535-544.
[5]	Yu ZHANG, Xiaoyuan WU, Lihua GUAN, Yiyuan LIU, Xingyue PENG, Haiyan XIE, Wei HU, Keke HAO, Ning XIA, Guojun LU, Zhibo HOU. Application of high-throughput drug sensitivity screening system in the treatment of non-small cell lung cancer with malignant pleural effusion [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(1): 82-89.
[6]	Bing-qian ZHOU, Li HAN, Zhe-yi CHEN, Shi-yu CHEN, Ying-xia ZHENG. Expression of protein arginine methyltransferase 5 in lung cancer and its mechanism of promoting lung cancer [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 1009-1016.
[7]	Sheng CHEN, Zhi-long YAN, Ye-ming WU, Min XU, Song GU, Jing MA. Expression and clinical significance of HIF-1α/SHH signaling pathway in neuroblastoma [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 1056-1061.
[8]	Xu-xin-yi LING, Yao ZHANG, Hua ZHONG. Research progress in screening non-small cell lung cancer patients who will benefit from immunotherapy [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 1114-1119.
[9]	Yan-qi HE, Rui CHI, Meng-ping CHEN, Si CHEN, Chun-liang LIU, Yun-xia LIU, Hai-peng SUN. Function of branched-chain amino acid catabolism in lung cancer cells [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(7): 858-864.
[10]	Yun-fang MA, Li-na PAN, Zhen LI, Bei-li GAO, Jia-an HU, Zhi-hong XU. Exploratory study on downregulation of PD-L1 in KRAS G12V-mutant non-small cell lung cancer cells by selumetinib [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(6): 741-748.
[11]	Jian-hua XU, Ping JIANG, Jiong DENG. Expression and significance of ATP-binding cassette superfamily G member 2 in lung cancer [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(6): 830-833.
[12]	Lu-lu CHEN, Xun-long XU, Wan-lan CHEN, Zhao-hui QIU. Effect of PDSORBS2 peptide on H9C2 cell apoptosis induced by hypoxia and reoxygenation [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(11): 1446-1453.
[13]	WANG Xiao-dan1, YANG Zhao1, SHEN Fan-xia1, 2. Single-stranded adeno-associated virus serotype 9 mediated gene expression in astrocyte via intravenous delivery [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(8): 1036-1040.
[14]	ZOU Chen1, 2, XU Run-hao1, 3, ZHANG Hong2, MA Zhan2, CHEN Li2, ZHANG Jie3, LI Min3, ZHANG Shu-lin1. Potential roles of small metabolites in the differential diagnosis between lung cancer and pneumonia [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(8): 1041-1047.
[15]	HE Chun-ming, YIN Hang, ZHENG Jia-jie, TANG Jian, FU Yu-jie, ZHAO Xiao-jing. Immunotherapy for lung cancer: immunosuppressive cells and intrapulmonary immunity [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(8): 1137-1142.