Journal of Shanghai Jiao Tong University (Medical Science) ›› 2022, Vol. 42 ›› Issue (11): 1534-1541.doi: 10.3969/j.issn.1674-8115.2022.11.003
• Basic research • Previous Articles
YUAN Yongmei(), CHENG Xiaodan, SUN Jiaan, CHANG Dongge, HE Yingying, LIU Chang(
)
Received:
2022-04-21
Accepted:
2022-08-21
Online:
2022-11-28
Published:
2023-01-04
Contact:
LIU Chang
E-mail:yuanyongmei1977@163.com;lcjzk0@163.com
Supported by:
CLC Number:
YUAN Yongmei, CHENG Xiaodan, SUN Jiaan, CHANG Dongge, HE Yingying, LIU Chang. lncRNA NEAT1 affects the proliferation, invasion and migration of ox-LDL-induced human vascular smooth muscle cells through miR-377-3p/Wnt pathway[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(11): 1534-1541.
Gene | Forward sequence (5'→3') | Reverse sequence (5'→3') |
---|---|---|
NEAT1 | CAATGACTTGGGGATGATGCAAACAATTACTG | GTACTCCCCACCTACACACCCAC |
WNT5A | GCGGGACTTTCTCAAGGACA | CGGCTGCCTATTTGCATCAC |
β-actin | AGTGCGACGTGGACATCCG | TGGCTCTAACAGTCCGCCTAG |
miR-377-3p | GGGAATCACACAAAGGCAAC | GTGCGTGTCGTGGAGTCG |
U6 | GCTTCGGCAGCACATATACTAAAAT | CGCTTCAGAATTTGCGTGTCAT |
Tab 1 Primer sequences of each gene
Gene | Forward sequence (5'→3') | Reverse sequence (5'→3') |
---|---|---|
NEAT1 | CAATGACTTGGGGATGATGCAAACAATTACTG | GTACTCCCCACCTACACACCCAC |
WNT5A | GCGGGACTTTCTCAAGGACA | CGGCTGCCTATTTGCATCAC |
β-actin | AGTGCGACGTGGACATCCG | TGGCTCTAACAGTCCGCCTAG |
miR-377-3p | GGGAATCACACAAAGGCAAC | GTGCGTGTCGTGGAGTCG |
U6 | GCTTCGGCAGCACATATACTAAAAT | CGCTTCAGAATTTGCGTGTCAT |
Fig 6 Western blotting detection of cell proliferation and EMT marker proteins expression in each groupNote: A. Control group. B. Model group. C. NEAT1 siRNA group. D. miR-377-3p inhibitor group. E. Transfection negative control group. F. Transfection+inhibition group.
1 | DONG Y, CHEN H W, GAO J L, et al. Molecular machinery and interplay of apoptosis and autophagy in coronary heart disease[J]. J Mol Cell Cardiol, 2019, 136: 27-41. |
2 | BENNETT M R, SINHA S, OWENS G K. Vascular smooth muscle cells in atherosclerosis[J]. Circ Res, 2016, 118(4): 692-702. |
3 | FENG Z B, ZHU Y P, ZHANG J, et al. Hsa-circ_0010283 regulates oxidized low-density lipoprotein-induced proliferation and migration of vascular smooth muscle cells by targeting the miR-133a-3p/pregnancy-associated plasma protein A axis[J]. Circ J, 2020, 84(12): 2259-2269. |
4 | ZOU L, XIA P F, CHEN L, et al. XIST knockdown suppresses vascular smooth muscle cell proliferation and induces apoptosis by regulating miR-1264/WNT5A/β-catenin signaling in aneurysm[J]. Biosci Rep, 2021, 41(3): BSR20201810. |
5 | LI H R, ZHAO Q F, CHANG L P, et al. LncRNA MALAT1 modulates ox-LDL induced EndMT through the Wnt/β-catenin signaling pathway[J]. Lipids Health Dis, 2019, 18(1): 62. |
6 | AHMED A S I, DONG K Z, LIU J H, et al. Long noncoding RNA NEAT1 (nuclear paraspeckle assembly transcript 1) is critical for phenotypic switching of vascular smooth muscle cells[J]. Proc Natl Acad Sci USA, 2018, 115(37): E8660-E8667. |
7 | ZHANG X, GUAN M X, JIANG Q H, et al. NEAT1 knockdown suppresses endothelial cell proliferation and induces apoptosis by regulating miR‑638/AKT/mTOR signaling in atherosclerosis[J]. Oncol Rep, 2020, 44(1): 115-125. |
8 | ZHAO L, BI M H, ZHANG H R, et al. Downregulation of NEAT1 suppresses cell proliferation, migration, and invasion in NSCLC via sponging miR-153-3p[J]. Cancer Biother Radiopharm, 2020, 35(5): 362-370. |
9 | LI T Y, DENG N H, XU R M, et al. NEAT1 siRNA packed with chitosan nanoparticles regulates the development of colon cancer cells via lncRNA NEAT1/miR-377-3p axis[J]. Biomed Res Int, 2021, 2021: 5528982. |
10 | ZHANG J S, LI Y L, DONG M, et al. Long non-coding RNA NEAT1 regulates E2F3 expression by competitively binding to miR-377 in non-small cell lung cancer[J]. Oncol Lett, 2017, 14(4): 4983-4988. |
11 | ZHANG P, WANG W P, LI M L. Circ_0010283/miR-377-3p/cyclin D1 axis is associated with proliferation, apoptosis, migration, and inflammation of oxidized low-density lipoprotein-stimulated vascular smooth muscle cells[J]. J Cardiovasc Pharmacol, 2021, 78(3): 437-447. |
12 | LIANG K, LIAO L, LIU Q, et al. microRNA-377-3p inhibits osteosarcoma progression by targeting CUL1 and regulating Wnt/β-catenin signaling pathway[J]. Clin Transl Oncol, 2021, 23(11): 2350-2357. |
13 | HUANG L F, LIU Z B, HU J, et al. miR-377-3p suppresses colorectal cancer through negative regulation on Wnt/β-catenin signaling by targeting XIAP and ZEB2[J]. Pharmacol Res, 2020, 156: 104774. |
14 | PARK N, KANG H. BMP-induced microRNA-101 expression regulates vascular smooth muscle cell migration[J]. Int J Mol Sci, 2020, 21(13): 4764. |
15 | ZHANG M, WANG X T, YAO J, et al. Long non-coding RNA NEAT1 inhibits oxidative stress-induced vascular endothelial cell injury by activating the miR-181d-5p/CDKN3 axis[J]. Artif Cells Nanomed Biotechnol, 2019, 47(1): 3129-3137. |
16 | YU X Y, LIU X Y, WANG R, et al. Long non-coding RNA NEAT1 promotes the progression of hemangioma via the miR-361-5p/VEGFA pathway[J]. Biochem Biophys Res Commun, 2019, 512(4): 825-831. |
17 | WANG L, XIA J W, KE Z P, et al. Blockade of NEAT1 represses inflammation response and lipid uptake via modulating miR-342-3p in human macrophages THP-1 cells[J]. J Cell Physiol, 2019, 234(4): 5319-5326. |
18 | LI B, XU W W, HAN L, et al. microRNA-377 suppresses initiation and progression of esophageal cancer by inhibiting CD133 and VEGF[J]. Oncogene, 2017, 36(28): 3986-4000. |
19 | SUN C C, LI S J, ZHANG F, et al. Long non-coding RNA NEAT1 promotes non-small cell lung cancer progression through regulation of miR-377-3p-E2F3 pathway[J]. Oncotarget, 2016, 7(32): 51784-51814. |
20 | LIU D, WANG X Y, ZHANG M J, et al. WISP1 alleviates lipid deposition in macrophages via the PPARγ/CD36 pathway in the plaque formation of atherosclerosis[J]. J Cell Mol Med, 2020, 24(20): 11729-11741. |
21 | LIU Y S, WEI M, LIU G, et al. Silencing protease-activated receptor-2 alleviates ox-LDL-induced lipid accumulation, inflammation and apoptosis via activation of Wnt/β-catenin signaling[J]. Gen Physiol Biophys, 2020, 39(5): 437-448. |
[1] | DING He, CAO Yanglin, HE Yang, WEI Xing, YANG Jianfeng. SMAD7 expression in multiple myeloma and its effect on cell proliferation and drug resistance [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(7): 858-865. |
[2] | HU Zhexuan, ZHANG Xin, WO Lulu, LI Jingchi, WANG Jiao, ZHOU Cixiang, ZHAO Qian. Study on the function of TRMT61A in liver cancer cell and its mechanism [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(6): 742-750. |
[3] | XU Feixiang, WANG Sheng, XUE Mingming, TONG Chaoyang, CHEN Yumei. Effect of altered expression of long non-coding RNA-B230352I09 on proliferation and cycle of H9C2 cardiomyocytes [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 578-582. |
[4] | LIU Ziyang, WANG Xiaowen, CHEN Li. lncRNA GK-IT1 influences the carcinogenesis of non-small cell lung cancer cells through regulating aldolase A [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(5): 591-601. |
[5] | Ming CHEN, Jing ZHANG. Inhibitory effect of sanguinarine on proliferaton and invasion of gastric cancer cells by upregulating m6A methyltransferase 14 [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2022, 42(2): 135-141. |
[6] | Bing-qian ZHOU, Li HAN, Zhe-yi CHEN, Shi-yu CHEN, Ying-xia ZHENG. Expression of protein arginine methyltransferase 5 in lung cancer and its mechanism of promoting lung cancer [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(8): 1009-1016. |
[7] | Yan-qi HE, Rui CHI, Meng-ping CHEN, Si CHEN, Chun-liang LIU, Yun-xia LIU, Hai-peng SUN. Function of branched-chain amino acid catabolism in lung cancer cells [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(7): 858-864. |
[8] | Xu TONG, Lin-jing SHU. Effect of miR-877-3p on proliferation of bone marrow mesenchymal stem cells in osteoporosis [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(7): 884-890. |
[9] | Shu-jun WAN, Xiang KONG, Kun LÜ. Relationship between non-coding RNAs and vascular diseases of diabetes mellitus [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2021, 41(5): 665-670. |
[10] | YAN Yu-qing, SHEN Chao-qin, CHEN Hao-yan, HONG Jie#, WANG Zhen-hua#. Expression of lnc-MTBP-5 in colorectal cancer and its effect on cell invasion [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(9): 1193-1201. |
[11] | DOU Min1, 2, ZHENG Ying-xia2, HAN Li2, ZHAO Qian1. Role and mechanism of PRMT4 in genesis and progression of gastric cancer [J]. JOURNAL OF SHANGHAI JIAOTONG UNIVERSITY (MEDICAL SCIENCE), 2020, 40(5): 609-618. |
[12] | CHENG Long, XU Wu-qin, ZHANG Peng, HUANG Jian-jun, LI Xiao-ning. Effect of miR-27a down-regulation on proliferation, migration and invasion in triple-negative breast cancer cells [J]. , 2020, 40(2): 188-. |
[13] | ZHANG Peng1, CHANG Zheng-yan2, YANG Lei1, XUE Song1, LIAN Feng1. Bioinformatics analysis of differentially expressed genes in ischemic cardiomyopathy [J]. , 2019, 39(7): 698-. |
[14] | HONG Xi1, LIU Li-jie1, HUANG Xian-yu2, LUO Jing2, YU Jian-jun1. Effects of BRD4 inhibitor on histone crotonylation, proliferation and migration of prostate cancer cells [J]. , 2019, 39(7): 721-. |
[15] | NING Hang, XIA Yi-ru, DONG Jia-chen, SHU Rong. Effect of recombinant human amelogenin-loaded PCLA-PEG-PCLA hydrogels on biological properties of human periodontal ligament fibroblasts [J]. , 2019, 39(3): 244-. |
Viewed | ||||||||||||||||||||||||||||||||||||||||||||||||||
Full text 1685
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||
Abstract 642
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||