lncRNA NEAT1 affects the proliferation, invasion and migration of ox-LDL-induced human vascular smooth muscle cells through miR-377-3p/Wnt pathway

doi:10.3969/j.issn.1674-8115.2022.11.003

Abstract

Abstract:

Objective ·To study the effects of long non-coding RNA (lncRNA) nuclear paraspeckle assembly transcript 1 (NEAT1) on the proliferation, invasion and migration of oxidized low-density lipoprotein (ox-LDL)-induced human vascular smooth muscle cells (HVSMCs) through regulating microRNA-377-3p (miR-377-3p) /Wnt pathway. Methods ·HVSMCs cultured in vitro were treated with 100 μg/mL ox-LDL. HVSMCs were randomly divided into control group, model group, NEAT1 siRNA group, miR-377-3p inhibitor group, transfection+inhibitor (NEAT1 siRNA+miR-377-3p inhibitor) group, and transfection-negative control (NEAT1 siRNA-negative control) group. Except for the control group, the atherosclerosis cell models were induced with 100 μg/mL ox-LDL in other groups. After grouping and transfection, the cell viability of each group was determined by using cell counting kit-8 (CCK-8) experiment; the apoptosis rate of each group was measured by flow cytometry; the migration and invasion of cells in each group were evaluated by the Transwell experiment; the expression of cell proliferation markers such as proliferating cell nuclear antigen (PCNA), and epithelial-mesenchymal transition (EMT) markers, such as E-cadherin and vimentin in each group, was determined by immunoblotting experiment; the expression of NEAT1, miR-377-3p and wingless-related MMTV integration site 5A (WNT5A) mRNA in each group was determined by qRT-PCR experiment. Results ·Compared with the control group, the mRNA expression of NEAT1 in the model group increased, the mRNA expression of miR-377-3p decreased, the apoptosis rate decreased, the cell viability, and the number of migrating and invasive cells increased, the protein expression of PCNA and Vimentin increased, the expression of E-cadherin decreased, and WNT5A mRNA expression increased (all P=0.000). After NEAT1 was interfered, the apoptosis rate increased, the cell viability, and the number of migrating and invasive cells decreased, the protein expression of PCNA and Vimentin decreased, the expression of E-cadherin increased, and WNT5A mRNA expression decreased (all P=0.000); after miR-377-3p was inhibited, all the above indicators showed opposite expression trends (P<0.05). In addition, inhibition of miR-377-3p reversed the regulation of NEAT1 interference on cell proliferation, invasion, migration and apoptosis (all P=0.000). Conclusion ·The down-regulating of NEAT1 expression may increase miR-377-3p expression by competitive binding to miR-377-3p, reduce protein expression associated with the Wnt pathway, inhibit the abnormal proliferation, invasion and migration of HVSMCs induced by ox-LDL, and induce apoptosis.

Key words: long non-coding RNA (lncRNA), nuclear paraspeckle assembly transcript 1 (NEAT1), microRNA-377-3p (miR-377-3p), human vascular smooth muscle cell (HVSMC), proliferation, invasion and migration

CLC Number:

R543.5

YUAN Yongmei, CHENG Xiaodan, SUN Jiaan, CHANG Dongge, HE Yingying, LIU Chang. lncRNA NEAT1 affects the proliferation, invasion and migration of ox-LDL-induced human vascular smooth muscle cells through miR-377-3p/Wnt pathway[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2022, 42(11): 1534-1541.

Figures/Tables 8

Tab 1 Primer sequences of each gene

Gene	Forward sequence （5'→3'）	Reverse sequence （5'→3'）
NEAT1	CAATGACTTGGGGATGATGCAAACAATTACTG	GTACTCCCCACCTACACACCCAC
WNT5A	GCGGGACTTTCTCAAGGACA	CGGCTGCCTATTTGCATCAC
β-actin	AGTGCGACGTGGACATCCG	TGGCTCTAACAGTCCGCCTAG
miR-377-3p	GGGAATCACACAAAGGCAAC	GTGCGTGTCGTGGAGTCG
U6	GCTTCGGCAGCACATATACTAAAAT	CGCTTCAGAATTTGCGTGTCAT

Fig 1 Relative expression of NEAT1, miR-377-3p and WNT5A mRNA in each group of cells (n=6)

Fig 2 Detection of apoptosis in each group by flow cytometry

Fig 3 Cell invasion in each group was detected by Transwell migration test

Fig 4 Cell migration was detected by Transwell invasion test

Fig 5 Number of invasive and migrating cells in each group

Fig 6 Western blotting detection of cell proliferation and EMT marker proteins expression in each groupNote: A. Control group. B. Model group. C. NEAT1 siRNA group. D. miR-377-3p inhibitor group. E. Transfection negative control group. F. Transfection+inhibition group.

Fig 7 Relative expression of PCNA, E-cadherin and vimentin proteins in each group of cells

TrendMD

References 21

1	DONG Y, CHEN H W, GAO J L, et al. Molecular machinery and interplay of apoptosis and autophagy in coronary heart disease[J]. J Mol Cell Cardiol, 2019, 136: 27-41.
2	BENNETT M R, SINHA S, OWENS G K. Vascular smooth muscle cells in atherosclerosis[J]. Circ Res, 2016, 118(4): 692-702.
3	FENG Z B, ZHU Y P, ZHANG J, et al. Hsa-circ_0010283 regulates oxidized low-density lipoprotein-induced proliferation and migration of vascular smooth muscle cells by targeting the miR-133a-3p/pregnancy-associated plasma protein A axis[J]. Circ J, 2020, 84(12): 2259-2269.
4	ZOU L, XIA P F, CHEN L, et al. XIST knockdown suppresses vascular smooth muscle cell proliferation and induces apoptosis by regulating miR-1264/WNT5A/β-catenin signaling in aneurysm[J]. Biosci Rep, 2021, 41(3): BSR20201810.
5	LI H R, ZHAO Q F, CHANG L P, et al. LncRNA MALAT1 modulates ox-LDL induced EndMT through the Wnt/β-catenin signaling pathway[J]. Lipids Health Dis, 2019, 18(1): 62.
6	AHMED A S I, DONG K Z, LIU J H, et al. Long noncoding RNA NEAT1 (nuclear paraspeckle assembly transcript 1) is critical for phenotypic switching of vascular smooth muscle cells[J]. Proc Natl Acad Sci USA, 2018, 115(37): E8660-E8667.
7	ZHANG X, GUAN M X, JIANG Q H, et al. NEAT1 knockdown suppresses endothelial cell proliferation and induces apoptosis by regulating miR‑638/AKT/mTOR signaling in atherosclerosis[J]. Oncol Rep, 2020, 44(1): 115-125.
8	ZHAO L, BI M H, ZHANG H R, et al. Downregulation of NEAT1 suppresses cell proliferation, migration, and invasion in NSCLC via sponging miR-153-3p[J]. Cancer Biother Radiopharm, 2020, 35(5): 362-370.
9	LI T Y, DENG N H, XU R M, et al. NEAT1 siRNA packed with chitosan nanoparticles regulates the development of colon cancer cells via lncRNA NEAT1/miR-377-3p axis[J]. Biomed Res Int, 2021, 2021: 5528982.
10	ZHANG J S, LI Y L, DONG M, et al. Long non-coding RNA NEAT1 regulates E2F3 expression by competitively binding to miR-377 in non-small cell lung cancer[J]. Oncol Lett, 2017, 14(4): 4983-4988.
11	ZHANG P, WANG W P, LI M L. Circ_0010283/miR-377-3p/cyclin D1 axis is associated with proliferation, apoptosis, migration, and inflammation of oxidized low-density lipoprotein-stimulated vascular smooth muscle cells[J]. J Cardiovasc Pharmacol, 2021, 78(3): 437-447.
12	LIANG K, LIAO L, LIU Q, et al. microRNA-377-3p inhibits osteosarcoma progression by targeting CUL1 and regulating Wnt/β-catenin signaling pathway[J]. Clin Transl Oncol, 2021, 23(11): 2350-2357.
13	HUANG L F, LIU Z B, HU J, et al. miR-377-3p suppresses colorectal cancer through negative regulation on Wnt/β-catenin signaling by targeting XIAP and ZEB2[J]. Pharmacol Res, 2020, 156: 104774.
14	PARK N, KANG H. BMP-induced microRNA-101 expression regulates vascular smooth muscle cell migration[J]. Int J Mol Sci, 2020, 21(13): 4764.
15	ZHANG M, WANG X T, YAO J, et al. Long non-coding RNA NEAT1 inhibits oxidative stress-induced vascular endothelial cell injury by activating the miR-181d-5p/CDKN₃ axis[J]. Artif Cells Nanomed Biotechnol, 2019, 47(1): 3129-3137.
16	YU X Y, LIU X Y, WANG R, et al. Long non-coding RNA NEAT1 promotes the progression of hemangioma via the miR-361-5p/VEGFA pathway[J]. Biochem Biophys Res Commun, 2019, 512(4): 825-831.
17	WANG L, XIA J W, KE Z P, et al. Blockade of NEAT1 represses inflammation response and lipid uptake via modulating miR-342-3p in human macrophages THP-1 cells[J]. J Cell Physiol, 2019, 234(4): 5319-5326.
18	LI B, XU W W, HAN L, et al. microRNA-377 suppresses initiation and progression of esophageal cancer by inhibiting CD133 and VEGF[J]. Oncogene, 2017, 36(28): 3986-4000.
19	SUN C C, LI S J, ZHANG F, et al. Long non-coding RNA NEAT1 promotes non-small cell lung cancer progression through regulation of miR-377-3p-E2F3 pathway[J]. Oncotarget, 2016, 7(32): 51784-51814.
20	LIU D, WANG X Y, ZHANG M J, et al. WISP1 alleviates lipid deposition in macrophages via the PPARγ/CD36 pathway in the plaque formation of atherosclerosis[J]. J Cell Mol Med, 2020, 24(20): 11729-11741.
21	LIU Y S, WEI M, LIU G, et al. Silencing protease-activated receptor-2 alleviates ox-LDL-induced lipid accumulation, inflammation and apoptosis via activation of Wnt/β-catenin signaling[J]. Gen Physiol Biophys, 2020, 39(5): 437-448.

[1]	ZHU Zijun, QIAN Yife, LI Qianyu, LI Songling, QIN Wenli, LIU Yanfeng. Anaphase-promoting complex subunit 10 promotes hepatocellular carcinoma progression through regulation of the PI3K-AKT-mTOR signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(9): 1171-1182.
[2]	YANG Na, LIU Junli, BAI Jing, YANG Siyi, HAN Jiming, ZHANG Huahua. HENMT1 promotes the proliferation and migration of gastric cancer by activating the PI3K-AKT-mTOR signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(6): 717-726.
[3]	XU Muxin, LIU Xian, JIANG Lishan, SUN Qing. Promotion of Nd:YAP laser biostimulation on the proliferation and osteogenic differentiation of human periodontal ligament cells through WNT/β-catenin signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(5): 562-569.
[4]	CHEN Yinan, ZHENG Yang, ZENG Hanlin, LEI Ming. Mechanism of Fas-associated protein with death domain in promoting proliferation of head and neck squamous cell carcinoma cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(4): 404-414.
[5]	ZHANG Xianzhou, DU Fenglin, WU Lei, REN Yizhe, ZHAO Mingna, LOU Jiatao. Mechanistic study of OGT-promoted non-small cell lung cancer proliferation via the ERK signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(10): 1288-1297.
[6]	LI Xiang, WEI Ming, WU Wenxi, LUO Xiaoqin, YAO Biao, WU Siyu. Inhibitory effect of rutin on the growth and metastasis of osteosarcoma in vitro and in vivo [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(1): 20-28.
[7]	SUN Chenwei, HAI Wangxi, QU Qian, XI Yun. [¹⁸F]F-FMISO and [¹⁸F]F-FLT PET/CT dual-nuclide imaging for in vivo prediction of drug resistance in pancreatic cancer [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(1): 60-68.
[8]	SHI Lingling, CHENG Yanyong, ZHANG Lei. Effects of sevoflurane exposure on proliferation and differentiation of primary oligodendrocytes [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(9): 1115-1123.
[9]	HAN Yishan, XU Ziqi, TAO Mengyu, FAN Guangjian, YU Bo. PRMT6 promotes the proliferation and migration of breast cancer cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(8): 999-1010.
[10]	TAN Lu, SHEN Shaoming, HE Ping. Function and mechanism study of hypoxia-induced long non-coding RNA 68 in hepatocellular carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(6): 702-712.
[11]	CAI Renjie, XU Ming. KHSRP regulates the responsiveness of prostate cancer cells to androgens through ANK3 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 417-426.
[12]	AN Junyi, CHEN Biying, CHEN Xunrui, YIN Shanshan, BIAN Zhouliang, LIU Feng. SFXN3 expression in head and neck squamous cell carcinoma and its effect on cell proliferation [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(4): 427-434.
[13]	LI Huxiao, LI Xiaotian, ZHAO Xuri, ZHANG Huanyu, ZHOU Wei, SONG Zhongchen. Effects of gingipain extract on the biological characteristics of oral squamous cell carcinoma cell HN6 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(2): 161-168.
[14]	LUO Lange, ZHENG Chao, LEI Ming. Promotive effect of cancer-testis antigen CT57 on proliferation, invasion, migration and epithelial-mesenchymal transition of liver cancer cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1335-1346.
[15]	KONG Ruxin, ZHOU Yaqun, WEI Tingyi, LEI Ming. Function and mechanism of cancer-testis antigen CT63 in chronic myeloid leukemia [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1347-1358.