Regulation of high-fat diet-induced microglial metabolism by transient receptor potential vanilloid type 1

doi:10.3969/j.issn.1674-8115.2023.12.004

Abstract

Abstract:

Objective ·Transcriptomic and lipidomic analysis techniques were used to investigate the role of transient receptor potential vanilloid type 1 (TRPV1) channel activation in the regulation of high-fat diet-induced microglial metabolism. Methods ·Eight-week-old C57BL/6J mice (WT) and Trpv1^-/- (KO) mice were used as experimental animals, and fed high-fat diet (HFD) for 3 days, 7 days, and 8 weeks to induce modelling (WT and KO groups, n = 3; WT-HFD and KO-HFD groups, n = 4). TRPV1 channel expression and cellular localisation were measured by immunofluorescence in the brains of mice in the WT-HFD and KO-HFD group. RNA sequencing and liquid chromatography-mass spectrometry were performed to determine the brain phenotype of mice in the WT-HFD and KO-HFD groups. Results ·The expression level of Trpv1 mRNA in microglia was significantly increased in mice in the WT-HFD group compared to mice in the WT group. The expression levels of genes related to brain lipid metabolism, mitochondrial function, glucose transfer, and glycolysis were down-regulated in the KO-HFD group of mice compared with the WT-HFD group of mice. Lipidomic analysis showed that although lipids accumulated in the brain tissue of mice in the KO-HFD group, Trpv1 knockdown attenuated HFD-induced microglia activation, and in addition the TRPV1 agonist capsaicin attenuated palmitate-induced depolarisation of mitochondrial membrane potential in vitro. Conclusion ·Together, these findings suggest that TRPV1 regulates lipid and glucose metabolism in microglia via fuel availability driven by a mitochondrial mechanism.

Key words: transient receptor potential vanilloid type 1(TRPV1), microglia, metabolism, lipid, mitochondria

CLC Number:

R964

SHA Xudong, WANG Chenfei, LU Jia, YU Zhihua. Regulation of high-fat diet-induced microglial metabolism by transient receptor potential vanilloid type 1[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(12): 1493-1506.

Figures/Tables 8

Tab 1 Primer sequences used for qRT-PCR （5'→3'）

Oligonucleotide	SOURCE	IDENTIFIER
mouse trpv1 FWD: TGGCTCATATTTGCCTTCAG mouse trpv1 REV: CAGCCCTAGGAGTTGATFGA	Sango Biotech	N/A
mouse ucp2 FWD: GCTGGTGGTTCGGAGAT mouse ucp2 REV: TGAAGTGGCAAGGGAGG	Sango Biotech	N/A
mouse tnf-α FWD: CAGGAGGGAGAACAGAAACTCCA mouse tnf-α REV: CCTGGTTGGCTGCTT	Sango Biotech	N/A
mouse il-1β FWD: GGAGGTGGTGATAGCCGGTAT mouse il-1β REV: TGGGTAATCCATAGAGCCCAG	Sango Biotech	N/A
mouse gapdh FWD: TGATGGCAACAATCTCCAC mouse gapdh REV: CGTCCCGTAGACAAAATGGT	Sango Biotech	N/A

Fig 1 WGCNA in WT and genetic Trpv1 deletion mice before and after high fat feeding

Fig 2 HFD induced liposome switch of brain cells with Trpv1 deficiency

Fig 3 Genetic Trpv1 deletion reduced HFD-induced multiple effects on brain transcriptome

Fig 4 Genetic Trpv1 deletion reduced HFD-induced multiple effects on metabolic pathways of the brain

Fig 5 Genetic Trpv1 deletion ameliorates HFD-induced microglia activation

Fig 6 Up-regulation of TRPV1 in active microglia and reactive astrocytes of HFD mice brains

Fig 7 Genetic Trpv1 deletion attenuate HFD-induced neuroinflammation and mitochondrial activation

TrendMD

References 49

1	SANDOVAL D A, OBICI S, SEELEY R J. Targeting the CNS to treat type 2 diabetes[J]. Nat Rev Drug Discov, 2009, 8(5): 386-398.
2	HORVATH T L, SARMAN B, GARCÍA-CÁCERES C, et al. Synaptic input organization of the melanocortin system predicts diet-induced hypothalamic reactive gliosis and obesity[J]. Proc Natl Acad Sci USA, 2010, 107(33): 14875-14880.
3	VALDEARCOS M, DOUGLASS J D, ROBBLEE M M, et al. Microglial inflammatory signaling orchestrates the hypothalamic immune response to dietary excess and mediates obesity susceptibility[J]. Cell Metab, 2018, 27(6): 1356.
4	KIM J D, YOON N A, JIN S, et al. Microglial UCP₂ mediates inflammation and obesity induced by high-fat feeding[J]. Cell Metab, 2019, 30(5): 952-962.e5.
5	CATERINA M J, SCHUMACHER M A, TOMINAGA M, et al. The capsaicin receptor: a heat-activated ion channel in the pain pathway[J]. Nature, 1997, 389(6653): 816-824.
6	MARRONE M C, MORABITO A, GIUSTIZIERI M, et al. TRPV1 channels are critical brain inflammation detectors and neuropathic pain biomarkers in mice[J]. Nat Commun, 2017, 8: 15292.
7	GIBSON H E, EDWARDS J G, PAGE R S, et al. TRPV1 channels mediate long-term depression at synapses on hippocampal interneurons[J]. Neuron, 2008, 57(5): 746-759.
8	MARINELLI S, MARZO V, BERRETTA N, et al. Presynaptic facilitation of glutamatergic synapses to dopaminergic neurons of the rat substantia nigra by endogenous stimulation of vanilloid receptors[J]. J Neurosci, 2003, 23(8): 3136-3144.
9	DOYLE M W, BAILEY T W, JIN Y H, et al. Vanilloid receptors presynaptically modulate cranial visceral afferent synaptic transmission in nucleus tractus solitarius[J]. J Neurosci, 2002, 22(18): 8222-8229.
10	EDWARDS J G. TRPV1 in the central nervous system: synaptic plasticity, function, and pharmacological implications[J]. Prog Drug Res, 2014, 68: 77-104.
11	KIM S R, KIM S U, OH U, et al. Transient receptor potential vanilloid subtype 1 mediates microglial cell death in vivo and in vitro via Ca²⁺-mediated mitochondrial damage and cytochrome c release[J]. J Immunol, 2006, 177(7): 4322-4329.
12	HASSAN S, ELDEEB K, MILLNS P J, et al. Cannabidiol enhances microglial phagocytosis via transient receptor potential (TRP) channel activation[J]. Br J Pharmacol, 2014, 171(9): 2426-2439.
13	MIYAKE T, SHIRAKAWA H, NAKAGAWA T, et al. Activation of mitochondrial transient receptor potential vanilloid 1 channel contributes to microglial migration[J]. Glia, 2015, 63(10): 1870-1882.
14	SAPPINGTON R M, CALKINS D J. Contribution of TRPV1 to microglia-derived IL-6 and NFkappaB translocation with elevated hydrostatic pressure[J]. Invest Ophthalmol Vis Sci, 2008, 49(7): 3004-3017.
15	SCHILLING T, EDER C. Importance of the non-selective cation channel TRPV1 for microglial reactive oxygen species generation[J]. J Neuroimmunol, 2009, 216(1/2): 118-121.
16	GAO W, SUN Y H, CAI M, et al. Copper sulfide nanoparticles as a photothermal switch for TRPV1 signaling to attenuate atherosclerosis[J]. Nat Commun, 2018, 9(1): 231.
17	BASKARAN P, KRISHNAN V, REN J, et al. Capsaicin induces browning of white adipose tissue and counters obesity by activating TRPV1 channel-dependent mechanisms[J]. Br J Pharmacol, 2016, 173(15): 2369-2389.
18	WEI T J, WANG Y X, XU W R, et al. KCa_3.1 deficiency attenuates neuroinflammation by regulating an astrocyte phenotype switch involving the PI3K/AKT/GSK3β pathway[J]. Neurobiol Dis, 2019, 132: 104588.
19	ZHANG B, HORVATH S. A general framework for weighted gene co-expression network analysis[J]. Stat Appl Genet Mol Biol, 2005, 4: Article17.
20	LANGFELDER P, HORVATH S. WGCNA: an R package for weighted correlation network analysis[J]. BMC Bioinformatics, 2008, 9: 559.
21	SHANNON P, MARKIEL A, OZIER O, et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks[J]. Genome Res, 2003, 13(11): 2498-2504.
22	ZHOU Y Y, ZHOU B, PACHE L, et al. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets[J]. Nat Commun, 2019, 10(1): 1523.
23	FALK T, YUE X, ZHANG S L, et al. Vascular endothelial growth factor-B is neuroprotective in an in vivo rat model of Parkinson's disease[J]. Neurosci Lett, 2011, 496(1): 43-47.
24	KORDOWER J H, EMBORG M E, BLOCH J, et al. Neurodegeneration prevented by lentiviral vector delivery of GDNF in primate models of Parkinson's disease[J]. Science, 2000, 290(5492): 767-773.
25	ARENA E T, RUEDEN C T, HINER M C, et al. Quantitating the cell: turning images into numbers with ImageJ[J]. Wiley Interdiscip Rev Dev Biol, 2017, 6(2): 10.1002/wdev.260.
26	TRIEBL A, TRÖTZMÜLLER M, HARTLER J, et al. Lipidomics by ultrahigh performance liquid chromatography-high resolution mass spectrometry and its application to complex biological samples[J]. J Chromatogr B Analyt Technol Biomed Life Sci, 2017, 1053: 72-80.
27	DIRCKS L, SUL H S. Acyltransferases of de novo glycerophospholipid biosynthesis[J]. Prog Lipid Res, 1999, 38(5/6): 461-479.
28	TRACEY T J, STEYN F J, WOLVETANG E J, et al. Neuronal lipid metabolism: multiple pathways driving functional outcomes in health and disease[J]. Front Mol Neurosci, 2018, 11: 10.
29	LEPROPRE S, KAUTBALLY S, OCTAVE M, et al. AMPK-ACC signaling modulates platelet phospholipids and potentiates thrombus formation[J]. Blood, 2018, 132(11): 1180-1192.
30	VANCE J E. Phospholipid synthesis and transport in mammalian cells[J]. Traffic, 2015, 16(1): 1-18.
31	MONNI M, CORAZZI L, MIGLIORATI G, et al. Respiratory state and phosphatidylserine import in brain mitochondria in vitro[J]. J Membrane Biol, 2000, 173(2): 97-105.
32	THOMAS H E, ZHANG Y, STEFELY J A, et al. Mitochondrial complex I activity is required for maximal autophagy[J]. Cell Rep, 2018, 24(9): 2404-2417.e8.
33	SHAHID R A, VIGNA S R, LAYNE A C, et al. Acinar cell production of leukotriene B₄ contributes to development of neurogenic pancreatitis in mice[J]. Cell Mol Gastroenterol Hepatol, 2015, 1(1): 75-86.
34	MA L Q, ZHONG J, ZHAO Z G, et al. Activation of TRPV1 reduces vascular lipid accumulation and attenuates atherosclerosis[J]. Cardiovasc Res, 2011, 92(3): 504-513.
35	LI L, CHEN J, NI Y X, et al. TRPV1 activation prevents nonalcoholic fatty liver through UCP₂ upregulation in mice[J]. Pflugers Arch - Eur J Physiol, 2012, 463(5): 727-732.
36	ZHAO J F, CHING L C, KOU Y R, et al. Activation of TRPV1 prevents OxLDL-induced lipid accumulation and TNF-α-induced inflammation in macrophages: role of liver X receptor Α[J]. Mediators Inflamm, 2013, 2013: 925171.
37	TANG W, FAN Y Y. SIRT6 as a potential target for treating insulin resistance[J]. Life Sci, 2019, 231: 116558.
38	LEE E, JUNG D Y, KIM J H, et al. Transient receptor potential vanilloid type-1 channel regulates diet-induced obesity, insulin resistance, and leptin resistance[J]. FASEB J, 2015, 29(8): 3182-3192.
39	RAZAVI R, CHAN Y, AFIFIYAN F N, et al. TRPV¹⁺ sensory neurons control beta cell stress and islet inflammation in autoimmune diabetes[J]. Cell, 2006, 127(6): 1123-1135.
40	GUILLEMOT-LEGRIS O, MUCCIOLI G G. Obesity-induced neuroinflammation: beyond the hypothalamus[J]. Trends Neurosci, 2017, 40(4): 237-253.
41	KETTENMANN H, HANISCH U K, NODA M, et al. Physiology of microglia[J]. Physiol Rev, 2011, 91(2): 461-553.
42	FERNANDES E S, BRITO C X L, TEIXEIRA S A, et al. TRPV1 antagonism by capsazepine modulates innate immune response in mice infected with Plasmodium berghei ANKA[J]. Mediators Inflamm, 2014, 2014: 506450.
43	MANES T D, WANG V, POBER J S. Divergent TCR-initiated calcium signals govern recruitment versus activation of human alloreactive effector memory T cells by endothelial cells[J]. J Immunol, 2018, 201(11): 3167-3174.
44	HUANG W X, YU F, SANCHEZ R M, et al. TRPV1 promotes repetitive febrile seizures by pro-inflammatory cytokines in immature brain[J]. Brain Behav Immun, 2015, 48: 68-77.
45	YOSHIDA A, FURUBE E, MANNARI T, et al. TRPV1 is crucial for proinflammatory STAT3 signaling and thermoregulation-associated pathways in the brain during inflammation[J]. Sci Rep, 2016, 6: 26088.
46	CHEN Y, WILLCOCKSON H H, VALTSCHANOFF J G. Influence of the vanilloid receptor TRPV1 on the activation of spinal cord glia in mouse models of pain[J]. Exp Neurol, 2009, 220(2): 383-390.
47	HO K W, WARD N J, CALKINS D J. TRPV1: a stress response protein in the central nervous system[J]. Am J Neurodegener Dis, 2012, 1(1): 1-14.
48	KONG W L, PENG Y Y, PENG B W. Modulation of neuroinflammation: role and therapeutic potential of TRPV1 in the neuro-immune axis[J]. Brain Behav Immun, 2017, 64: 354-366.
49	LEONELLI M, MARTINS D O, BRITTO L R G. TRPV1 receptors are involved in protein nitration and Müller cell reaction in the acutely axotomized rat retina[J]. Exp Eye Res, 2010, 91(5): 755-768.

[1]	Lu Bohan, Hu Cuirong, Wang Jinkun, Lu Jifang, Jin Haijiao, Wang Ling, Jiang Na, Mou Shan. Association between hyperuricemia and metabolic syndrome in adults [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(4): 486-495.
[2]	Miao Keyan, Jia Hao, Yang Xi. Arachidonic acid metabolism in tumor immune microenvironment remodeling [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(4): 521-528.
[3]	Chen Jiayu, Zhang Huili. Role and mechanism of fibroblast mitochondrial dysfunction in pulmonary arterial hypertension [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(3): 291-300.
[4]	Xu Zhoulin, Yin Gaosheng, Li Yuancong, Yang Yunheng, Zheng Qi, Yang Ping. Study on the role of gastrodin-mediated autophagy in skeletal muscle atrophy after myocardial infarction [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(3): 301-311.
[5]	Wang Guanzhen, He Wenrui, Tong Xuemei. Mechanisms and therapeutic applications of transketolase in regulating pentose phosphate metabolism and mitochondrial function [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(2): 137-142.
[6]	Wu Kexin, Lu Jia, Wu Xingyu, Yu Zhihua. Role of microglial TRPV1 in apolipoprotein E4-associated Parkinson's disease [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(2): 163-171.
[7]	Wu Di, Ma Jun. Research progress on mitochondrial pathological mechanisms and targeted therapy in children with autism spectrum disorder [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(1): 115-122.
[8]	ZHU Zijun, QIAN Yife, LI Qianyu, LI Songling, QIN Wenli, LIU Yanfeng. Anaphase-promoting complex subunit 10 promotes hepatocellular carcinoma progression through regulation of the PI3K-AKT-mTOR signaling pathway [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(9): 1171-1182.
[9]	JIANG Jie, ZHANG Hong, LUN Heyuan, PAN Fen, YU Fangyuan, HE Ping. Molecular epidemiology of Klebsiella pneumoniae isolated from children [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(8): 1027-1034.
[10]	KERANMU Saitierguli, QIAN Lei, DING Siyi, MAHELIMUHAN Hanati, YANG Xueer, JIA Hao. Research progress of arginine metabolism in the regulation of mesenchymal stem cell function [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(7): 910-915.
[11]	HUANG Yinghe, ZHAO Guanyu, SUN Yang, HOU Jianji, ZUO Yong. Research progress on macrophage metabolic regulation in wound healing of diabetes mellitus type 2 [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(6): 792-799.
[12]	YU Kai, SHUAI Zhewei, HUANG Hongjun, LUO Yan. Research progress on the role and mechanisms of microglia in inflammatory diseases of central nervous system [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(5): 630-638.
[13]	LU Yefeng, GAO Leiqing, NI Xiaoxiao, FU Jingjing. Multitime-point monitoring and analysis of influencing factors of early postoperative blood glucose and lipid levels in pediatric liver transplantation [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(4): 443-451.
[14]	ZOU Peichen, LIU Hongyu, AIHEMAITI· Ayinazhaer, ZHU Liang, TANG Yabin, LEI Huimin. Metabolic profiling of lung cancer cells with acquired resistance to sotorasib [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(2): 138-149.
[15]	DU Tailai, HUANG Zhanpeng. Advances in metabolic modulators as therapeutic agents for heart failure [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(12): 1636-1643.