Anti-leukemia effect of B7 gene-modified leukemia cell-derived exosomes

doi:10.3969/j.issn.1674-8115.2025.02.001

Abstract

Abstract:

Objective ·To investigate the immunotherapeutic effects of exosomes derived from leukemia cells with high expression of B7 molecules (co-stimulatory molecules CD80 and CD86) in tumor-bearing mice. Methods ·L1210 leukemia cells were transfected with lentiviral vectors containing the CD80 and CD86 genes, and thereby the leukemia cells with high expression of CD80 and CD86 molecules were obtained. Exosomes LEX-8086 with high expression of CD80 and CD86 molecules were then isolated from the culture supernatant. The biological characteristics of LEX-8086 were analyzed by using transmission electron microscopy (TEM) and Western blotting. A DBA/2-leukemia tumor-bearing mouse model was established. The tumor-bearing mice were divided into LEX-8086 group and PBS group. The LEX-8086 group received intravenous injections of 500 μL LEX-8086 (150 μg/mL) via the tail vein 7 d and 12 d after tumor cell inoculation, while the PBS group received injections of equal volumes of PBS at the same time points. Differences in body weight, tumor volume, tumor mass, and survival of the mice between the two groups were observed. Flow cytometry was used to analyze the changes in the immune cells in spleens and lymph nodes of the mice in both groups. Western blotting and real-time fluorescent quantitative PCR (qPCR) were used to detect the expression of markers for M1 and M2 macrophages in the spleens of the mice in both groups. Results ·The exosomes LEX-8086 were isolated from the supernatant of L1210 cells overexpressing CD80 and CD86 molecules. TEM revealed that LEX-8086 exhibited a disc-shaped vesicular structure with a diameter of approximately 100 nm. Western blotting demonstrated the expression of exosome-specific markers. In the animal experiments, compared with the PBS group, the body weight of the LEX-8086 group showed no significant change, while both the tumor volume and the relative tumor mass ratio decreased significantly, and the survival was significantly prolonged (all P<0.05). Flow cytometry results indicated that the proportions of natural killer (NK) cells and CD4⁺ T cells in the lymph nodes and spleens of the LEX-8086 group significantly increased (all P<0.05); as for CD8⁺ T cells, they only increased in the lymph modes (P=0.012). Moreover, flow cytometry results showed that the proportion of M1 macrophages in the spleens of mice in the LEX-8086 group was significantly elevated (P=0.003), while the proportion of M2 macrophages remained unchanged. Western blotting and qPCR also revealed that the mRNA and protein expression levels of M1 macrophage markers interleukin-6 and tumor necrosis factor-α in the spleens of mice in the LEX-8086 group increased significantly (all P<0.05). Conclusion ·Exosomes derived from leukemia cells with high expression of co-stimulatory molecules CD80 and CD86 can induce a therapeutic anti-leukemic effect, which may be achieved by increasing the proportions of NK cells, M1 macrophages, CD4⁺ T cells, and CD8⁺ T cells.

Key words: leukemia, exosome, costimulatory molecule, gene modification, immunotherapy

CLC Number:

R557

ZHANG Difan, WANG Minghui, ZHAO Jie, WAN Jiangbo, HUANG Fang, HAO Siguo. Anti-leukemia effect of B7 gene-modified leukemia cell-derived exosomes[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(2): 129-137.

Figures/Tables 9

Tab 1 Primer sequences for qPCR

Gene	Forward primer (5'→3')	Reverse primer (5'→3')
Cd206	GGGTTGCTATCACTCTCTATGC	TTTCTTGTCTGTTGCCGTAGTT
Il-10	GACTTTAAGGGTTACCTGGGTTG	TCACATGCGCCTTGATGTCTG
Il-6	ACTCACCTCTTCAGAACGAATTG	CCATCTTTGGAAGGTTCAGGTTG
Tnf-α	ACCAGCAGATGGGCTGTACC	GCGGAGAGGAGGCTGACTTT
Gadph	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG

Fig 1 Biological characteristics of L1210-CD8086 cells and exosomes LEX-8086

Fig 2 Changes in body weight and survival time of DBA/2-leukemia tumor-bearing mice in the two groups

Fig 3 Tumor volume and tumor weight of DBA/2-leukemia tumor-bearing mice in the two groups

Fig 4 Proportions of NK cells in the lymph nodes and spleens of DBA/2-leukemia tumor-bearing mice in the two groups determined by flow cytometry

Fig 5 Proportions of CD4+ T cells and CD8+ T cells in the lymph nodes and spleens of DBA/2-leukemia tumor-bearing mice in the two groups determined by flow cytometry

Fig 6 Proportions of M1 and M2 macrophages in the spleens of DBA/2-leukemia tumor-bearing mice in the two groups determined by flow cytometry

Fig 7 mRNA expression levels of macrophage markers in the spleens of DBA/2-leukemia tumor-bearing mice in the two groups detected by RT-qPCR

Fig 8 Protein expression levels of IL-6 and TNF-α in the spleens of DBA/2-leukemia tumor-bearing mice in the two groups detected by Western blotting

TrendMD

References 18

1	WHITESIDE T L. Tumor-derived exosomes and their role in cancer progression[J]. Adv Clin Chem, 2016, 74: 103-141.
2	SUN Z Y, XIE C Q, LIU H, et al. CD19 CAR-T cell therapy induced immunotherapy associated interstitial pneumonitis: a case report[J]. Front Immunol, 2022, 13: 778192.
3	RAJE N, BERDEJA J, LIN Y, et al. Anti-BCMA CAR T-cell therapy bb2121 in relapsed or refractory multiple myeloma[J]. N Engl J Med, 2019, 380(18): 1726-1737.
4	OTT P A, HU Z T, KESKIN D B, et al. An immunogenic personal neoantigen vaccine for patients with melanoma[J]. Nature, 2017, 547(7662): 217-221.
5	SHEIH A, VOILLET V, HANAFI L A, et al. Clonal kinetics and single-cell transcriptional profiling of CAR-T cells in patients undergoing CD19 CAR-T immunotherapy[J]. Nat Commun, 2020, 11(1): 219.
6	CHEN G, HUANG A C, ZHANG W, et al. Exosomal PD-L1 contributes to immunosuppression and is associated with anti-PD-1 response[J]. Nature, 2018, 560(7718): 382-386.
7	AHMAD A. Epigenetic regulation of immunosuppressive tumor-associated macrophages through dysregulated microRNAs[J]. Semin Cell Dev Biol, 2022, 124: 26-33.
8	NASERI M, BOZORGMEHR M, ZÖLLER M, et al. Tumor-derived exosomes: the next generation of promising cell-free vaccines in cancer immunotherapy[J]. Oncoimmunology, 2020, 9(1): 1779991.
9	KRACKHARDT A M, HARIG S, WITZENS M, et al. T-cell responses against chronic lymphocytic leukemia cells: implications for immunotherapy[J]. Blood, 2002, 100(1): 167-173.
10	TOWNSEND S E, ALLISON J P. Tumor rejection after direct costimulation of CD8⁺ T cells by B7-transfected melanoma cells[J]. Science, 1993, 259(5093): 368-370.
11	CHENG Q Z, KANG Y, YAO B, et al. Genetically engineered-cell-membrane nanovesicles for cancer immunotherapy[J]. Adv Sci (Weinh), 2023, 10(26): e2302131.
12	HU W W, HUANG F, NING L X, et al. Enhanced immunogenicity of leukemia-derived exosomes via transfection with lentiviral vectors encoding costimulatory molecules[J]. Cell Oncol (Dordr), 2020, 43(5): 889-900.
13	LI J Q, HUANG F, JIANG Y, et al. A novel costimulatory molecule gene-modified leukemia cell-derived exosome-targeted CD4⁺ T cell vaccine efficiently enhances anti-leukemia immunity[J]. Front Immunol, 2022, 13: 1043484.
14	JOHNSON B D, YAN X C, SCHAUER D W, et al. Dual expression of CD80 and CD86 produces a tumor vaccine superior to single expression of either molecule[J]. Cell Immunol, 2003, 222(1): 15-26.
15	VASILEVKO V, GHOCHIKYAN A, HOLTERMAN M J, et al. CD80 (B7-1) and CD86 (B7-2) are functionally equivalent in the initiation and maintenance of CD4⁺ T-cell proliferation after activation with suboptimal doses of PHA[J]. DNA Cell Biol, 2002, 21(3): 137-149.
16	SIVORI S, PENDE D, QUATRINI L, et al. NK cells and ILCs in tumor immunotherapy[J]. Mol Aspects Med, 2021, 80: 100870.
17	TRACY S I, VENKATESH H, HEKIM C, et al. Combining nilotinib and PD-L1 blockade reverses CD4⁺ T-cell dysfunction and prevents relapse in acute B-cell leukemia[J]. Blood, 2022, 140(4): 335-348.
18	DISTLER E, ALBRECHT J, BRUNK A, et al. Patient-individualized CD8⁺ cytolytic T-cell therapy effectively combats minimal residual leukemia in immunodeficient mice[J]. Int J Cancer, 2016, 138(5): 1256-1268.

[1]	TANG Wenjing, JIA Jie, YANG Kefeng, MAO Xuanxia, SONG Fangfang. Research progress on milk-derived exosomes in sarcopenia [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(8): 1046-1052.
[2]	MENG Jing, XIE Yuting, ZUO Jiaxin, XIONG Ping. Nanoengineered T cell system for the in vitro treatment of oral squamous cell carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(7): 866-873.
[3]	CHEN Zixuan, LIU Min. Research progress on immune cell therapy in renal cell carcinoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(7): 916-925.
[4]	TANG Junqian, LI Benshang. Advances in the treatment of pediatric B-cell acute lymphoblastic leukemia with high-risk cytogenetics [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2025, 45(10): 1390-1399.
[5]	HE Rui, YAN Kepeng, WANG Jing. Targeting folate cycle enhances effects of cancer immunotherapy by modulating myeloid-derived suppressor cells [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(8): 1011-1022.
[6]	HU Fei, CAI Xiaohan, CHENG Rui, JI Shiyu, MIAO Jiaxin, ZHU Yan, FAN Guangjian. Progress in translational research on immunotherapy for osteosarcoma [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(7): 814-821.
[7]	DING Yanling, LI Jie, YUAN Jun, LI Yan. Research progress in targeted therapies of chronic lymphocytic leukemia [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(2): 264-270.
[8]	LIU Jiayu, HUANG Fang, HAO Siguo. A case of chronic myelomonocytic leukemia complicated with immune thrombocytopenia [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(2): 287-290.
[9]	TANG Sijie, MI Jianqing. Clinical advances in antibody-drug conjugates for hematological malignancies [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(12): 1607-1614.
[10]	KONG Ruxin, ZHOU Yaqun, WEI Tingyi, LEI Ming. Function and mechanism of cancer-testis antigen CT63 in chronic myeloid leukemia [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(11): 1347-1358.
[11]	FANG Xinyue, SHI Lan, XIA Siyi, WANG Jiaxuan, WU Yingli, HE Kejun. Research progress in Menin-MLL interaction and its inhibitors in MLL-rearranged leukemia [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(10): 1287-1298.
[12]	ZHOU Haixia, ZHANG Jing. Research progress of m⁶A methylation modification in regulating tumor immunity [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2024, 44(1): 137-144.
[13]	CUI Zhiyan, CHEN Yao, TAO Yue, SHEN Shuhong, LI Hui. Effects of PRPS1 I72 mutations on drug resistance in acute lymphoblastic leukemia and its mechanisms [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(8): 977-987.
[14]	WU Qiqi, WANG Hao, LIN Li, YAN Bo, ZHANG Shulin. miR-185-5p facilitates intracellular Mycobacterium growth via inhibiting macrophage autophagy [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(6): 699-708.
[15]	LI Ying, TAN Yangxia, YIN Hongxin, JIANG Yanling, CHEN Li, MENG Guoyu. Research progress in the pathogenesis and prognosis of ZNF384 fusion subtype acute leukemia [J]. Journal of Shanghai Jiao Tong University (Medical Science), 2023, 43(5): 631-640.