Effects of triclosan exposure on the invasion ability of triple-negative breast cancer cells

doi:10.3969/j.issn.1674-8115.2026.04.004

Abstract

Abstract:

Objective ·To investigate the effect of triclosan (TCS) exposure on the progression of triple-negative breast cancer (TNBC) and to explore the underlying mechanism. Methods ·Cell counting kit-8 (CCK-8) assay was used to detect the half-maximal inhibitory concentration of TCS in the TNBC cell line MDA-MB-231 to screen the exposure concentrations of TCS. The effects of TCS on the migration and invasion abilities of MDA-MB-231 cells were detected by wound-healing assay and Transwell invasion assays, respectively. The effect of TCS on miR-21 expression in MDA-MB-231 cells was detected by quantitative real-time PCR (qPCR). The effects of TCS on the expression of epithelial-mesenchymal transition (EMT)-related proteins, including E-cadherin (E-cad) and vimentin in MDA-MB-231 cells, were detected by Western blotting. The effect of TCS exposure on the miR-21/signal transducer and activator of transcription 3 (STAT3) signaling pathway were detected by immunohistochemistry and Western blotting. Meanwhile, miR-21 mimics were transfected into MDA-MB-231 cells to examine the effects of TCS exposure on the migration and invasion of the cells. Results ·According to the CCK-8 assay, the exposure concentrations of TCS were screened to be 0.001, 0.01, 0.1, and 1 μmol/L. Wound-healing assay and Transwell invasion assay both showed that exposure to 0.01, 0.1, and 1 μmol/L TCS enhanced the migration and invasion abilities of MDA-MB-231 cells (all P<0.05). qPCR results indicated that the expression level of miR-21 in TNBC cells was decreased after exposure to 0.01, 0.1, and 1 μmol/L TCS (all P<0.05). Western blotting results revealed that 0.1 and 1 μmol/L TCS downregulated the expression of the epithelial marker E-cad, and 0.01, 0.1, and 1 μmol/L TCS upregulated the expression of the mesenchymal marker vimentin (all P<0.05). Immunohistochemistry and Western blotting results demonstrated that exposure to 0.01, 0.1, and 1 μmol/L TCS increased the phosphorylation of STAT3 in a dose-dependent manner (all P<0.05). Upregulation of miR-21 by transfection with miR-21 mimics attenuated the promoting effect of TCS on the migration and invasion of TNBC cells (both P<0.05). Conclusion ·TCS exposure enhances the migration and invasion of TNBC cells via the miR-21/STAT3 signaling axis, suggesting that TCS exposure may exert a promoting effect on the progression of TNBC.

Key words: triclosan (TCS), triple-negative breast cancer (TNBC), invasion, miRNA-21, signal transducer and activator of transcription 3 (STAT3)

CLC Number:

R737.9

Tong Youhua, Guo Sinan, Nie Yu, Gao Yaxuan, Liu Shiyan, Zhang Haohao, Hou Yinghao, Zhi Hui. Effects of triclosan exposure on the invasion ability of triple-negative breast cancer cells[J]. Journal of Shanghai Jiao Tong University (Medical Science), 2026, 46(4): 442-450.

Figures/Tables 7

Tab 1 Primer sequences for qPCR

Primer	Forward (5'→3')	Reverse (5'→3')
miR-21	ACACTCCAGCTGGGTAGCTTATCAGACTGA	TGGTGTCGTGGAGTCG
U6	CGATACAGAGAAGATTAGCATGGC	AACGCTTCACGAATTTGCGT

Fig 1 Screening of TCS exposure concentrations by CCK-8 assay

Fig 2 Effect of TCS exposure on the migration and invasion abilities of MDA-MB-231 cells

Fig 3 Effect of TCS exposure on EMT in MDA-MB-231 cells

Fig 4 Effect of TCS exposure on the STAT3 signaling pathway

Fig 5 Effect of TCS exposure on miR-21 expression levels

Fig 6 Effect of miR-21 overexpression on TCS-induced STAT3 activation, cell migration, and invasion

TrendMD

References 29

[1]	Fines C, McCarthy H, Buckley N. The search for a TNBC vaccine: the guardian vaccine[J]. Cancer Biol Ther, 2025, 26(1): 2472432.
[2]	Liu Y H, Zou Y H, Ye Y L, et al. Advances in the understanding of the pathogenesis of triple-negative breast cancer[J]. Cancer Med, 2024, 13(22): e70410.
[3]	Garrido-Castro A C, Lin N U, Polyak K. Insights into molecular classifications of triple-negative breast cancer: improving patient selection for treatment[J]. Cancer Discov, 2019, 9(2): 176-198.
[4]	Koual M, Tomkiewicz C, Cano-Sancho G, et al. Environmental chemicals, breast cancer progression and drug resistance[J]. Environ Health, 2020, 19(1): 117.
[5]	许秋瑾, 应光国, 夏青, 等. 洗涤剂对水环境的风险及防控对策建议[J]. 环境工程技术学报, 2019, 9(6): 775-780.
	Xu Q J, Ying G G, Xia Q, et al. The risk of detergent to water environment and its prevention and control countermeasure suggestions[J]. Journal of Environmental Engineering Technology, 2019, 9(6): 775-780.
[6]	Ma X Q, Wan Y J, Wu M Y, et al. Occurrence of benzophenones, parabens and triclosan in the Yangtze River of China, and the implications for human exposure[J]. Chemosphere, 2018, 213: 517-525.
[7]	Zhu Q Q, Wang M, Jia J B, et al. Occurrence, distribution, and human exposure of several endocrine-disrupting chemicals in indoor dust: a nationwide study[J]. Environ Sci Technol, 2020, 54(18): 11333-11343.
[8]	Rodgers K M, Udesky J O, Rudel R A, et al. Environmental chemicals and breast cancer: an updated review of epidemiological literature informed by biological mechanisms[J]. Environ Res, 2018, 160: 152-182.
[9]	Lee G A, Choi K C, Hwang K A. Kaempferol, a phytoestrogen, suppressed triclosan-induced epithelial-mesenchymal transition and metastatic-related behaviors of MCF-7 breast cancer cells[J]. Environ Toxicol Pharmacol, 2017, 49: 48-57.
[10]	Ge J Y, Zuo W J, Chen Y Y, et al. The advance of adjuvant treatment for triple-negative breast cancer[J]. Cancer Biol Med, 2021, 19(2): 187-201.
[11]	Meng D S, Li Y R, Chen Z, et al. Exosomes derived from antler mesenchymal stem cells promote wound healing by miR-21-5p/STAT3 axis[J]. Int J Nanomedicine, 2024, 19: 11257-11273.
[12]	Tse J, Pierce T, Carli A L E, et al. Onco-miR-21 promotes Stat3-dependent gastric cancer progression[J]. Cancers, 2022, 14(2): 264.
[13]	Yang Z L, Liang Z Y, Rao J, et al. Hypoxic-preconditioned mesenchymal stem cell-derived small extracellular vesicles promote the recovery of spinal cord injury by affecting the phenotype of astrocytes through the miR-21/JAK2/STAT3 pathway[J]. CNS Neurosci Ther, 2024, 30(3): e14428.
[14]	Ma C, Shi T, Qu Z, et al. CircRNA_ACAP2 suppresses EMT in head and neck squamous cell carcinoma by targeting the miR-21-5p/STAT3 signaling axis[J]. Front Oncol, 2020, 10: 583682.
[15]	Grimaldi A M, Salvatore M, Incoronato M. miRNA-based therapeutics in breast cancer: a systematic review[J]. Front Oncol, 2021, 11: 668464.
[16]	Bao S, He C P, Ku P J, et al. Effects of triclosan on the RedoximiRs/Sirtuin/Nrf2/ARE signaling pathway in mosquitofish (Gambusia affinis)[J]. Aquat Toxicol, 2021, 230: 105679.
[17]	Zhao C, Xie R, Qian Q, et al. Triclosan induced zebrafish immunotoxicity by targeting miR-19a and its gene socs3b to activate IL-6/STAT3 signaling pathway[J]. Sci Total Environ, 2022, 815: 152916.
[18]	Farasani A, Darbre P D. Long-term exposure to triclosan increases migration and invasion of human breast epithelial cells in vitro[J]. J Appl Toxicol, 2021, 41(7): 1115-1126.
[19]	Yi K F, Chen W Y, Zhou X, et al. Bisphenol S exposure promotes stemness of triple-negative breast cancer cells via regulating Gli1-mediated Sonic hedgehog pathway[J]. Environ Res, 2025, 264(Pt 1): 120293.
[20]	Lee G A, Hwang K A, Choi K C. Inhibitory effects of 3, 3'-diindolylmethane on epithelial-mesenchymal transition induced by endocrine disrupting chemicals in cellular and xenograft mouse models of breast cancer[J]. Food Chem Toxicol, 2017, 109(Pt 1): 284-295.
[21]	Wang N, Wei L, Huang Y X, et al. miR520c blocks EMT progression of human breast cancer cells by repressing STAT3[J]. Oncol Rep, 2017, 37(3): 1537-1544.
[22]	Liao P A, Chu P Y, Tan Z L, et al. STAT3 inactivation and induction of apoptosis associate with fluoxetine-inhibited epithelial-mesenchymal transition and growth of triple-negative breast cancer in vivo[J]. Anticancer Res, 2022, 42(8): 3807-3814.
[23]	Shi M J, Lin Z H, Ye L H, et al. Estrogen receptor-regulated SOCS3 modulation via JAK2/STAT3 pathway is involved in BPF-induced M1 polarization of macrophages[J]. Toxicology, 2020, 433/434: 152404.
[24]	Wu C Y, Yin K Z, Zhang Y, et al. 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin promotes proliferation of astrocyte cells via the Akt/STAT3/Cyclin D1 pathway[J]. Biomed Environ Sci, 2019, 32(4): 281-290.
[25]	Wang Z Y, Wang J, Fu Q, et al. Efficient evaluation of osteotoxicity and mechanisms of endocrine disrupting chemicals using network toxicology and molecular docking approaches: triclosan as a model compound[J]. Ecotoxicol Environ Saf, 2025, 293: 118030.
[26]	Zhang X N, Sai B Q, Wang F, et al. Hypoxic BMSC-derived exosomal miRNAs promote metastasis of lung cancer cells via STAT3-induced EMT[J]. Mol Cancer, 2019, 18(1): 40.
[27]	Diao W Q, Qian Q H, Sheng G Y, et al. Triclosan targets miR-144 abnormal expression to induce neurodevelopmental toxicity mediated by activating PKC/MAPK signaling pathway[J]. J Hazard Mater, 2022, 431: 128560.
[28]	Yang Y, Ni D Y, Wang L, et al. Triclosan has a strong influence on the development of mouse preimplantation embryo via activating miR-134/Nanog axis[J]. Toxicology, 2022, 481: 153349.
[29]	Wang X Y, Ren T, Zhang X N, et al. miR-21 suppression in macrophages promotes M2-like polarization and attenuates kidney ischemia-reperfusion injury[J]. FASEB J, 2024, 38(23): e70251.